ID: 1039533909

View in Genome Browser
Species Human (GRCh38)
Location 8:38290234-38290256
Sequence CTATAAACACAGATTATTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 244}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039533909 Original CRISPR CTATAAACACAGATTATTCT AGG (reversed) Intronic
905559721 1:38916905-38916927 CTATATACAGAGATTATCCTGGG + Intronic
906993634 1:50766326-50766348 TTATAAACAAAAAGTATTCTAGG - Intronic
907112085 1:51935569-51935591 CAACAAACTCAGGTTATTCTTGG + Intronic
907816145 1:57919969-57919991 CTATAAATCCAGATTAGGCTGGG - Intronic
908149830 1:61288622-61288644 CTATCAGGACATATTATTCTTGG - Intronic
908669042 1:66525224-66525246 CTGCAAACACAAATCATTCTAGG + Intergenic
909146069 1:71933653-71933675 CTTTAATCAGAGATTATTCAGGG - Intronic
909362858 1:74784692-74784714 CTATAAGCAAGGATTATTCTGGG + Intergenic
910076333 1:83283583-83283605 CTATGAATACATATTATGCTAGG + Intergenic
911092485 1:94029077-94029099 ATATAAACACAGATAATGTTTGG - Intronic
911501110 1:98685625-98685647 CTTAAAATACAGATTATACTAGG - Intronic
915150331 1:153825741-153825763 CCATAAGCAAACATTATTCTTGG - Intronic
917479081 1:175395078-175395100 ATATAAACAGAGATAATTATAGG + Intronic
918519057 1:185394849-185394871 CTGTAAACACAGATAGTTCTGGG - Intergenic
918660687 1:187084061-187084083 TTATAAACAGTGATTATCCTGGG - Intergenic
918672910 1:187242425-187242447 CTATAAATATAGATTTTTCTAGG - Intergenic
921624381 1:217362226-217362248 TTGTAAACACAGACTTTTCTTGG - Intergenic
922147863 1:222966606-222966628 CTATCACCACAGATTAGTTTTGG - Intronic
924949569 1:248870066-248870088 CTAAAAACAAAAATTATGCTGGG + Intergenic
1063492361 10:6476378-6476400 CTATAAACACATTTTAGACTGGG - Intronic
1064743958 10:18461088-18461110 CTAAAAACACAAAATTTTCTGGG - Intronic
1068318038 10:55373230-55373252 CTATATACAAAGATTATTTCAGG + Intronic
1068761105 10:60710394-60710416 TTATAAACACAGACCATTCATGG - Intronic
1071451537 10:85796159-85796181 CTGGAATCACAGATAATTCTGGG + Intronic
1071760787 10:88603965-88603987 CCATGAACACAGAATATTATAGG - Intronic
1073197699 10:101706635-101706657 CTATAAACCCACATCACTCTTGG + Intergenic
1074310866 10:112322205-112322227 CTATAAACAAAGCTTGTACTGGG - Intergenic
1075278824 10:121121191-121121213 CCATAACCACAGACTATGCTTGG + Intergenic
1078326054 11:10381708-10381730 CAATAATCATAGACTATTCTGGG - Intronic
1079955353 11:26855947-26855969 CTATAAAGACAGATATTTTTTGG + Intergenic
1080012767 11:27474441-27474463 CTATAAAACCAGAGTTTTCTGGG - Intergenic
1081215377 11:40390151-40390173 GTTTAAACAGAGATTATTCATGG - Intronic
1082014357 11:47473334-47473356 CTAAAAACAGAGATTCATCTGGG + Intronic
1085728432 11:78975458-78975480 CTGTGACCACAGATTATTCAAGG - Intronic
1086009901 11:82089114-82089136 GCATAAACACAGAATATTATTGG + Intergenic
1086218800 11:84416317-84416339 CTGGAAACACTGATTTTTCTTGG - Intronic
1086814831 11:91356945-91356967 CTAGAAAAACGGATTAATCTAGG - Intergenic
1087150852 11:94858338-94858360 CTACAAATATAAATTATTCTAGG - Intronic
1089726689 11:120486815-120486837 CTAAAAACACAGATCAATTTAGG - Exonic
1093588416 12:20870632-20870654 GTATACACACAGATTTCTCTGGG + Intronic
1097307938 12:58089740-58089762 CTATAATTAGAAATTATTCTGGG - Intergenic
1098610782 12:72454860-72454882 CCCTAAACACAGATTGTTCATGG + Intronic
1098765650 12:74485441-74485463 CTTTAAACATAGATTGTTCCGGG - Intergenic
1098927613 12:76368738-76368760 CAATAAAGACAAATTATTCAAGG - Intronic
1099052400 12:77796442-77796464 CTTGAAACACAGTCTATTCTGGG + Intergenic
1099466598 12:82995588-82995610 CTTCAAACACAGTTAATTCTGGG + Intronic
1099675652 12:85757007-85757029 CTATAGACATAGAATATTCTAGG + Intergenic
1100148436 12:91706359-91706381 CTATAGACACAGCTTATGGTTGG + Intergenic
1104256572 12:127144617-127144639 TTATAAATACAGAATATTTTAGG - Intergenic
1104327087 12:127809731-127809753 CTATCATCAAAGATCATTCTTGG - Intergenic
1105956254 13:25286237-25286259 TTAAAAACACAAATTCTTCTTGG + Intronic
1106013548 13:25847182-25847204 CTAGAAACACAGAACATTCTGGG + Intronic
1106072448 13:26425607-26425629 TTGCAAACACAGACTATTCTTGG - Intergenic
1107216835 13:37931550-37931572 ATATAAACATAGATGCTTCTGGG + Intergenic
1107222160 13:37995907-37995929 CAATAAACAAAGTTTTTTCTGGG + Intergenic
1107255647 13:38423071-38423093 CTCTAAACACACAGTACTCTAGG + Intergenic
1107266226 13:38558786-38558808 CTATAAAAGTAGATTATTGTAGG + Intergenic
1107497998 13:40947519-40947541 CTATAAACATAGTTAATCCTGGG + Intronic
1108059248 13:46516070-46516092 TGATAAACACATATTATGCTTGG - Intergenic
1110357697 13:74587151-74587173 CTAAGAATACAGAATATTCTGGG + Intergenic
1111182686 13:84688797-84688819 TTATAATCACTGATTATTGTGGG - Intergenic
1112464368 13:99630583-99630605 GTATAAAGACATATTATTTTTGG + Intronic
1112972521 13:105277951-105277973 CAATAATCACAGATGCTTCTTGG + Intergenic
1114618954 14:24083328-24083350 CTATAAGAACACATTATCCTTGG - Intronic
1115098548 14:29669935-29669957 CCATAAACACACATTATTGGTGG + Intronic
1115141880 14:30181388-30181410 CTATAATCAGAGAGTAATCTAGG + Intronic
1115388876 14:32830785-32830807 TAATAAACACAGATTATTGGGGG + Exonic
1116384784 14:44316755-44316777 CTAAAAACACAGTTTCTTTTGGG - Intergenic
1116835156 14:49763237-49763259 CTAAAAAGACAGATGATTATAGG - Intergenic
1117626234 14:57641757-57641779 CTATTAATACAAAGTATTCTAGG - Intronic
1118286647 14:64480443-64480465 CGATTAACACAGATTATGGTCGG + Exonic
1118813201 14:69290445-69290467 CACCAAACACAGATGATTCTGGG - Intronic
1120657106 14:87204269-87204291 TTACAAAAACAGATTTTTCTTGG - Intergenic
1121071880 14:91030906-91030928 TTAAAAACACAGAATAATCTTGG + Intronic
1121647565 14:95529981-95530003 CTAGATACACAGATGATTTTTGG - Intergenic
1202937991 14_KI270725v1_random:110251-110273 ATATAAAGACACATGATTCTTGG - Intergenic
1125100392 15:35905713-35905735 ATATAAACACATTTTTTTCTAGG - Intergenic
1133598473 16:7316127-7316149 ATATAAACACATAATCTTCTTGG - Intronic
1133645159 16:7757156-7757178 GTATATACACAGAATAATCTAGG + Intergenic
1133728163 16:8556289-8556311 CTATAGACAGAGATCCTTCTAGG + Intergenic
1135372643 16:21918426-21918448 CTGAAAACACAGATTTTTTTTGG - Intergenic
1135439140 16:22452275-22452297 CTGAAAACACAGATTTTTTTTGG + Intergenic
1136948486 16:34686108-34686130 ATATAAAGACACATGATTCTTGG + Intergenic
1141025487 16:80542741-80542763 CTATAAAAACAAAGTATTCCAGG - Intronic
1144552767 17:16255955-16255977 CTTCAAAGCCAGATTATTCTGGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1149520280 17:57313579-57313601 CTCAAAACAATGATTATTCTTGG + Intronic
1149703608 17:58675695-58675717 TTGTAAACAAAGCTTATTCTGGG - Intronic
1150708557 17:67510196-67510218 CTTTAGACCCAGATTAGTCTAGG - Intronic
1153314528 18:3708891-3708913 CTTTAAAAACAGATTTTTCAGGG + Intronic
1155015877 18:21838829-21838851 GTATCAACACAGATGGTTCTTGG - Intronic
1155101091 18:22610754-22610776 CTATAAAATAATATTATTCTTGG - Intergenic
1155250685 18:23950631-23950653 CTTTAAAACCAGATTCTTCTAGG + Intronic
1156134363 18:34019154-34019176 TTATAAACACACAATATGCTTGG + Intronic
1156179163 18:34582640-34582662 AGAGAAACACAGGTTATTCTTGG - Intronic
1156511849 18:37643536-37643558 TTACAAACACATATTATCCTAGG + Intergenic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1159688283 18:71451627-71451649 CTGTAAATGCAGTTTATTCTGGG + Intergenic
1161339503 19:3733360-3733382 CTAGAAACACACAATCTTCTGGG - Intronic
1168458276 19:56532750-56532772 TCAGAAACACTGATTATTCTTGG + Intergenic
925567889 2:5276403-5276425 ATTTAAACAAACATTATTCTGGG - Intergenic
926095316 2:10077757-10077779 CTAGAATCACAGATTATTCGAGG - Intronic
926649161 2:15322650-15322672 CTATAAAGTCAGATTATGTTAGG + Intronic
927233372 2:20847342-20847364 CTCTCAACCCAGATTATTTTGGG + Intergenic
927730839 2:25470265-25470287 CTAAAGTCACTGATTATTCTGGG - Intronic
928435550 2:31252318-31252340 CTATTCACACAGATTACTCTGGG - Intronic
930186187 2:48414481-48414503 CTATAAACACAGATTAATACAGG - Intergenic
931286389 2:60835466-60835488 ATATAAAAACAGATTTTTCTGGG + Intergenic
931544739 2:63370268-63370290 CTATAAAATCACATTTTTCTAGG + Intronic
932076196 2:68665368-68665390 CTTTAAACACAGATCATTATAGG + Intergenic
932998757 2:76893475-76893497 CTCTAAATACAGATTATTTCTGG + Intronic
934676863 2:96255541-96255563 CTCTATAAACTGATTATTCTAGG - Intronic
934956446 2:98624364-98624386 CTATAAACAAAGAATATTACCGG - Exonic
936723415 2:115281910-115281932 CTAAAACTAAAGATTATTCTTGG - Intronic
937737649 2:125312160-125312182 TTATAAACATAGAATATTCTAGG - Intergenic
937746026 2:125416632-125416654 TTATAAAAGCAAATTATTCTGGG + Intergenic
941074883 2:160995589-160995611 ACATAAACACACATTAGTCTAGG - Intergenic
941450521 2:165654920-165654942 TTAAAAACACAGATGATTCCGGG - Intronic
941699962 2:168593777-168593799 AGATAAATACAGGTTATTCTAGG - Intronic
942990425 2:182193767-182193789 CTATAAACACCGATTACACCAGG - Intronic
942995485 2:182255178-182255200 CTATAAACACAGGTTGATCTAGG - Intronic
944466058 2:200000785-200000807 ATATAAACACAGACTATCTTGGG + Intronic
945808919 2:214524250-214524272 CTATCTACCCAAATTATTCTTGG + Intronic
948251852 2:236535944-236535966 TTATAAAGACAGGTTTTTCTTGG + Intergenic
1169704993 20:8493317-8493339 CTCTAAACTCAAATTATTTTTGG - Intronic
1172049864 20:32109317-32109339 ATATAATTACAAATTATTCTTGG + Intergenic
1172092236 20:32441484-32441506 GTATAAACACAGATTTTATTAGG - Intergenic
1172462309 20:35128742-35128764 CTACAAACACACATTAGCCTAGG - Intronic
1173031319 20:39363505-39363527 CTATAAATAAACATTATTATGGG + Intergenic
1173122158 20:40303798-40303820 ACACAAACACAGATAATTCTGGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1177259426 21:18710988-18711010 CTATAAACTCAAATTCTTATTGG - Intergenic
1177753283 21:25313538-25313560 CCATAAACACAAATTATGATTGG - Intergenic
1177806255 21:25877789-25877811 CTATTAAAAAAGATTATTTTCGG + Intergenic
1177928045 21:27243313-27243335 CTAAAAACACAAATTTTTATTGG + Intergenic
1182039845 22:27229144-27229166 CAATAAACACTTATTTTTCTAGG - Intergenic
1182435701 22:30328293-30328315 CTATATTCACAGCTAATTCTGGG - Intergenic
1183762067 22:39830375-39830397 CTGAAAAGACAGATTATTTTAGG - Intronic
949236102 3:1810458-1810480 CTGTAAACACTTGTTATTCTAGG - Intergenic
949503333 3:4703225-4703247 CGATACACACAGCTTATTCAAGG + Intronic
953364796 3:42334923-42334945 GTATAAACACAGAAAATACTTGG - Intergenic
954889420 3:53910939-53910961 CAAAAAACAAAGATTATTTTGGG - Intergenic
955625249 3:60911524-60911546 CTTTAAACCCAGATCATTCATGG + Intronic
956660852 3:71595781-71595803 CAATAAAGCCAGATTTTTCTAGG + Intergenic
958491877 3:94785705-94785727 ATTTATACCCAGATTATTCTGGG + Intergenic
959149197 3:102588366-102588388 CTATAAACTCATAGTATTGTGGG - Intergenic
959169609 3:102829118-102829140 CTATAAACAAAGTTAATTTTTGG - Intergenic
959568840 3:107860425-107860447 CTATAAACACACATTTTCCTGGG - Intergenic
959578864 3:107963938-107963960 CTAAAATCTCAGATTTTTCTGGG - Intergenic
962504949 3:136037180-136037202 CCATAAACACAGAGTTTTCTAGG - Intronic
963288933 3:143466816-143466838 CTATAAACAGACATCATCCTAGG + Intronic
966664453 3:182455031-182455053 CTATCAACACAGAATATTTCTGG - Intergenic
967116769 3:186348090-186348112 CTAAAAACTCAGATTACTCAAGG - Intronic
967673849 3:192272208-192272230 ATAAAGACACAGTTTATTCTAGG + Intronic
969038861 4:4277892-4277914 CTACAAACACAGGGTATGCTGGG + Intronic
969929797 4:10619928-10619950 CGATTAACACAGAGTATTATGGG - Intronic
970037933 4:11760468-11760490 TGATAAACACAGTTTATTCCTGG + Intergenic
970422567 4:15919059-15919081 CTATAAACACACAATGTCCTAGG - Intergenic
970557545 4:17249771-17249793 CTAAAAAAACAGATCTTTCTAGG - Intergenic
971615599 4:28787038-28787060 CTTTATACAGAGAGTATTCTAGG + Intergenic
972184303 4:36510102-36510124 CAATAAACACTGATTGTTATTGG - Intergenic
973681653 4:53326967-53326989 TTATAAAGACAGATTTTGCTTGG - Intronic
974181624 4:58390996-58391018 TTATCAACATAGATGATTCTAGG - Intergenic
976597669 4:86909150-86909172 CTTTTAACACAAATTATTCAGGG + Intronic
977747431 4:100566548-100566570 CCATAAAGAAAGATTAGTCTTGG + Intronic
979119246 4:116873728-116873750 CAATACACACAAATTATCCTAGG + Intergenic
980717211 4:136641797-136641819 CTATATCCACAGATAATACTTGG + Intergenic
981445143 4:144827926-144827948 CTATTAAGAGAGATCATTCTAGG - Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
983300535 4:165919667-165919689 GGATAAATACAGCTTATTCTAGG + Intronic
984427885 4:179611477-179611499 CTGTAAAAACAGAGTATTCTGGG - Intergenic
984449495 4:179881624-179881646 TTATAAACACAGGTTTTTGTGGG - Intergenic
985406144 4:189640013-189640035 CAATCAACACAGAAGATTCTGGG - Intergenic
988025418 5:25680617-25680639 ATATAAACATAGTTTATTCTAGG - Intergenic
988412156 5:30900198-30900220 TCATACACACAGATTTTTCTTGG - Intergenic
988873467 5:35417036-35417058 CTAGAAACTCATATTATTCGAGG + Intergenic
989227147 5:39042095-39042117 CTATAAATGCAGATTACTGTGGG - Intronic
989827690 5:45878577-45878599 ATATAAACACTGCTTTTTCTTGG + Intergenic
990811942 5:59736328-59736350 CTAAAATAACAGAATATTCTGGG + Intronic
990998046 5:61753116-61753138 GTATAAACAGAGATTGTTCTGGG - Intergenic
991391587 5:66149760-66149782 TTATAATCACAGATTGTTTTTGG + Intronic
991918496 5:71629530-71629552 CCATAACCAAAGATGATTCTTGG - Intronic
992165019 5:74040863-74040885 CTATAAGCAGGGATTCTTCTAGG + Intergenic
992335101 5:75759177-75759199 ATCTAAACATAGATTATTTTTGG + Intergenic
992707332 5:79410165-79410187 CTAGAAAGACAGATTATTAAAGG - Intronic
993234781 5:85290479-85290501 TTTCAAACACAGATTACTCTTGG - Intergenic
996160283 5:120153630-120153652 CTATAAACAAAGAGTTATCTTGG - Intergenic
997031341 5:130132500-130132522 ATAGAATCACACATTATTCTTGG + Intronic
997403356 5:133620566-133620588 CTTTAAACACAGCCTATTATGGG + Intergenic
998461258 5:142311829-142311851 TTGTAAACACGGATTTTTCTGGG - Exonic
1000589581 5:163143033-163143055 CAATAAATACAGATTTTTCATGG + Intergenic
1001367404 5:171157147-171157169 CTAAAAACCCAGATATTTCTTGG - Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1008509812 6:52265754-52265776 CTGTAACCTCAGATTCTTCTTGG - Intronic
1008833196 6:55794301-55794323 CTGTAAGCCCAAATTATTCTGGG + Exonic
1009817519 6:68755059-68755081 CTATAAACACAACTTAATTTAGG + Intronic
1010006042 6:70996615-70996637 CCAAACTCACAGATTATTCTGGG + Intergenic
1010144751 6:72654737-72654759 AGATAAAGATAGATTATTCTTGG + Intronic
1011055404 6:83198567-83198589 CTACACACACAGCTTATTTTGGG + Exonic
1011508724 6:88076870-88076892 CTATAAAAAGAGATTAAACTTGG - Intergenic
1012656103 6:101823159-101823181 CTATAATCTCAGATTCTCCTGGG + Intronic
1012783573 6:103593831-103593853 CCATAAACCCAGATAATTCTGGG + Intergenic
1013599911 6:111694065-111694087 CTCCAAAAACAGAGTATTCTAGG + Intronic
1014406331 6:121056401-121056423 CTATAAAAACTGATTAGTTTGGG + Intergenic
1014889317 6:126823337-126823359 CTATAAAGACAGCTCATTCCAGG - Intergenic
1015473068 6:133628398-133628420 CTAGAAACAGAGATTATGCATGG + Intergenic
1015649124 6:135434916-135434938 AGAAAAACACAGATTATTCCAGG + Intronic
1016097613 6:140057645-140057667 TTATAAGCACAGAATATTATTGG + Intergenic
1016253815 6:142079260-142079282 CTATAAAGACAGAATATTGTTGG - Intronic
1016445377 6:144126548-144126570 TTATAAACTCAAATTATTCCTGG + Intergenic
1016630822 6:146228916-146228938 CTATAAACAAAGATATTTATTGG - Intronic
1017584562 6:155906323-155906345 CTAGAAATACAGATTTTTCTTGG - Intergenic
1019204195 6:170345183-170345205 TTATAAACAAAACTTATTCTGGG - Intronic
1021059772 7:16096951-16096973 CAATGAACACATTTTATTCTTGG + Intronic
1025480286 7:60974818-60974840 ATATAGACACATATGATTCTTGG + Intergenic
1026579808 7:71605695-71605717 CTCTAACCCCAGATTATCCTGGG - Intronic
1027454287 7:78368557-78368579 TTATATACACATATTTTTCTTGG - Intronic
1027847644 7:83402892-83402914 CTTTAAGCAAAGAATATTCTAGG + Intronic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1030275450 7:107716454-107716476 CTTTAAACACAGACTACTATAGG - Exonic
1030839501 7:114330782-114330804 CTATAAACAGATATTATTGTCGG - Intronic
1031149224 7:118033600-118033622 GTATAAACGCAGATTGTTTTAGG + Intergenic
1031229646 7:119089200-119089222 CTAAAAACATAGATGAATCTGGG - Intergenic
1031389802 7:121200266-121200288 ATATAAAAACAGAAAATTCTGGG + Intronic
1032945779 7:136851017-136851039 TTATCCACACAGATTATTCATGG + Intergenic
1037422673 8:18720496-18720518 CTGTAAACACATATAATTCCAGG - Intronic
1038105190 8:24425286-24425308 CTACAGACACAGATTATGGTAGG - Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1039350302 8:36756868-36756890 CTATAAAAGCTGATTATTCCAGG + Intergenic
1039533909 8:38290234-38290256 CTATAAACACAGATTATTCTAGG - Intronic
1039651570 8:39345669-39345691 TTATAAATATATATTATTCTTGG + Intergenic
1041133862 8:54734963-54734985 CTTTAAAGACAGTTTATTTTAGG + Intergenic
1041422169 8:57679914-57679936 CCATAAACATAAATTATTGTGGG + Intergenic
1042077536 8:65013057-65013079 CTAGAAACTCAGAATATTCAGGG - Intergenic
1045339670 8:101242036-101242058 CCATTAACACAGATTATTTTTGG + Intergenic
1045997837 8:108384107-108384129 CAATAAACAAACTTTATTCTAGG + Intronic
1048110355 8:131461382-131461404 CTATAGACACAGATTCCTGTGGG + Intergenic
1048665347 8:136655190-136655212 ATATAAATCCAGTTTATTCTTGG - Intergenic
1051188315 9:14483884-14483906 CTGAAAACACATTTTATTCTTGG + Intergenic
1051388172 9:16533327-16533349 TTATAAAAACAGAATAATCTAGG - Intronic
1052418161 9:28204690-28204712 TTAAAAACACAAATTCTTCTTGG - Intronic
1053698960 9:40667496-40667518 ATAAAGACACATATTATTCTTGG - Intergenic
1054310249 9:63466897-63466919 ATAAAGACACATATTATTCTTGG - Intergenic
1054409038 9:64791049-64791071 ATAAAGACACATATTATTCTTGG - Intergenic
1054442197 9:65274863-65274885 ATAAAGACACATATTATTCTTGG - Intergenic
1054488083 9:65746634-65746656 ATAAAGACACATATTATTCTTGG + Intergenic
1054944231 9:70777882-70777904 ATATACACACAGATAATTATAGG + Intronic
1057787502 9:98098093-98098115 CTCTAACCACAGATTAGTATGGG - Intronic
1058627336 9:106948575-106948597 CTGTGAATAGAGATTATTCTGGG - Intronic
1059875747 9:118632650-118632672 TTAAAAAGACAGATTAATCTGGG - Intergenic
1059969994 9:119657356-119657378 GTCTAAACACTGATTTTTCTTGG + Intergenic
1060614005 9:124994618-124994640 CTATAAAAGAAAATTATTCTGGG + Intronic
1062145537 9:134987708-134987730 CTATCAATACGGATTATTCCAGG + Intergenic
1185937152 X:4270606-4270628 CTATAAATAAATATAATTCTAGG + Intergenic
1186201299 X:7157842-7157864 ATATCAAGACAAATTATTCTGGG + Intergenic
1186870772 X:13769521-13769543 ACATAAAAACAGATTTTTCTAGG + Intergenic
1187603039 X:20853408-20853430 ATATAATCACAAACTATTCTGGG + Intergenic
1187801085 X:23063780-23063802 CTATAACCACAGATCTTCCTGGG - Intergenic
1188380976 X:29491960-29491982 ATAGAAACAAAGATTATTGTAGG - Intronic
1188630252 X:32348258-32348280 TTATAAATGCAGAATATTCTTGG - Intronic
1192717113 X:73655359-73655381 CTATATACACACAATATTGTGGG + Intronic
1193273642 X:79558618-79558640 CAAAAACCACAGATTATTTTAGG - Intergenic
1193825989 X:86227885-86227907 TCAAAAACAAAGATTATTCTAGG - Intronic
1195719169 X:107849450-107849472 CTCTAGACACAGATTATTTCAGG - Intronic
1197615412 X:128685077-128685099 CTATAAAAGCAGCATATTCTTGG + Intergenic
1198040356 X:132844985-132845007 CTATTAAAATAGAATATTCTGGG + Intronic
1201721354 Y:17101036-17101058 CTGTAAACTCAGATGCTTCTTGG - Intergenic