ID: 1039536923

View in Genome Browser
Species Human (GRCh38)
Location 8:38324874-38324896
Sequence CCTTCGTGTGTTCAGCAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 17, 3: 70, 4: 215}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039536923_1039536928 -4 Left 1039536923 8:38324874-38324896 CCAGGTTGCTGAACACACGAAGG 0: 1
1: 0
2: 17
3: 70
4: 215
Right 1039536928 8:38324893-38324915 AAGGTGCCTGTAGGGTGGCATGG No data
1039536923_1039536927 -9 Left 1039536923 8:38324874-38324896 CCAGGTTGCTGAACACACGAAGG 0: 1
1: 0
2: 17
3: 70
4: 215
Right 1039536927 8:38324888-38324910 ACACGAAGGTGCCTGTAGGGTGG No data
1039536923_1039536931 6 Left 1039536923 8:38324874-38324896 CCAGGTTGCTGAACACACGAAGG 0: 1
1: 0
2: 17
3: 70
4: 215
Right 1039536931 8:38324903-38324925 TAGGGTGGCATGGCCAGAGAGGG No data
1039536923_1039536932 11 Left 1039536923 8:38324874-38324896 CCAGGTTGCTGAACACACGAAGG 0: 1
1: 0
2: 17
3: 70
4: 215
Right 1039536932 8:38324908-38324930 TGGCATGGCCAGAGAGGGCATGG No data
1039536923_1039536930 5 Left 1039536923 8:38324874-38324896 CCAGGTTGCTGAACACACGAAGG 0: 1
1: 0
2: 17
3: 70
4: 215
Right 1039536930 8:38324902-38324924 GTAGGGTGGCATGGCCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039536923 Original CRISPR CCTTCGTGTGTTCAGCAACC TGG (reversed) Intronic
901599279 1:10410019-10410041 CCTACGTGTGTTGATCAAGCAGG + Intronic
901889460 1:12250159-12250181 CCCTCCAGTGTTCAGCAACCTGG + Intronic
902306308 1:15542367-15542389 CCTCCATGTGTTCAGCCACCTGG - Intronic
902313015 1:15596491-15596513 GCTCCGTATGTTCACCAACCTGG - Intergenic
903042475 1:20541764-20541786 CCTCCATGTGTTCAGCTATCTGG + Intergenic
905810340 1:40908172-40908194 CCTCCACGTGTTCAGCTACCCGG - Intergenic
906454552 1:45982529-45982551 CCCTCCTGTGTTCACCAACCAGG - Intronic
907010303 1:50957100-50957122 CATTTGTGTGTTTAGGAACCTGG - Intronic
909131299 1:71740558-71740580 CTTTCCTGTGTTCAGCAGACAGG - Intronic
909264543 1:73539643-73539665 CATGGCTGTGTTCAGCAACCAGG - Intergenic
909297690 1:73971418-73971440 CATTGATGTGTTCACCAACCTGG + Intergenic
910361933 1:86421591-86421613 CCTTTTTGTTATCAGCAACCAGG - Intergenic
911189426 1:94933015-94933037 CCTTCATGGGTTCAGCTACCTGG + Intergenic
911334144 1:96560869-96560891 CCTTAGTATGTTCACCAACCTGG - Intergenic
911741865 1:101395029-101395051 CCTTCATGTGTTCAGCTATCTGG - Intergenic
912261556 1:108115917-108115939 CCTCTGTGAGGTCAGCAACCTGG - Intergenic
912858997 1:113196333-113196355 CCTCCATGTGTTCAGCTATCTGG - Intergenic
912988530 1:114459355-114459377 CCTCCACGTGTTCAGTAACCTGG - Intronic
913675920 1:121140016-121140038 CCTCCATGTGCTCAGCTACCTGG - Intergenic
914027816 1:143927956-143927978 CCTCCATGTGCTCAGCTACCTGG - Intergenic
914460274 1:147877449-147877471 CCTTCAGGTGTTGAGCAGCCTGG + Intergenic
915091714 1:153430704-153430726 TCTTGGTGTGTCCAGGAACCTGG - Intergenic
915727370 1:158027338-158027360 CCTCCCTGTGTTCAGCTACCTGG + Intronic
916176301 1:162041995-162042017 CCTTGATGTGTTCAACAACCTGG - Intergenic
917241308 1:172951466-172951488 CCTTCATGTGTTCACCAACCTGG - Intergenic
917443588 1:175088038-175088060 CCTCCACTTGTTCAGCAACCAGG + Intronic
917557349 1:176103418-176103440 CCTCAGTGTGTTCACCAACCTGG - Intronic
918019991 1:180678150-180678172 CATTCATGTGTTCACCAACTTGG + Intronic
919525704 1:198647354-198647376 CATTCGTTTGTTCAGCAAACAGG - Intronic
920008761 1:202852685-202852707 CCTTCGCCGGTTCAGCACCCAGG - Intergenic
920463290 1:206158853-206158875 CCTCCATGTGCTCAGCTACCTGG - Intergenic
921068340 1:211638706-211638728 CCTCCCTGTGTTCAGCTATCCGG + Intergenic
922229798 1:223675858-223675880 CCTCCATGAGTTCAGCAGCCTGG - Intergenic
922432756 1:225571797-225571819 CCTTCATATGTTGATCAACCTGG - Intronic
922807171 1:228396362-228396384 CCTCAGTGTGCTCACCAACCTGG - Intronic
922966880 1:229697836-229697858 CCTTCATGTGTTCAGCTATCTGG + Intergenic
923293251 1:232567970-232567992 CCTTCATGTGTTCAGCTGTCTGG - Intergenic
923849894 1:237782843-237782865 GCTTAATGTGCTCAGCAACCTGG - Intronic
924758586 1:246964144-246964166 CCTCCGCGTGTTCAGCAGCCCGG + Intronic
924808270 1:247378964-247378986 CCTTTGTGTGTCAAGCAATCTGG + Intergenic
924855206 1:247868861-247868883 CCTCCGTGTGTTCAGTGATCTGG + Intronic
1062871419 10:908249-908271 CCTCCATGTGTTCAGCTATCTGG - Intronic
1065176525 10:23081687-23081709 CCTTCCTGAGTTTAGCCACCTGG + Intergenic
1065209353 10:23388063-23388085 CCTCCAAGTGTTCAGCAACCTGG + Intergenic
1066281117 10:33919249-33919271 CCTCCTTGTGTTCAGCAACCTGG + Intergenic
1067708240 10:48627059-48627081 CCTCCATGTGTTCACCAACCCGG - Intronic
1070023194 10:72606936-72606958 CCTTCATGAGTTCACCAGCCTGG - Intronic
1070491680 10:76982449-76982471 CCTTAGTCTGTTCAGCATCATGG - Intronic
1071098082 10:82002590-82002612 CCTTCCTGAGGTCAGCAACTTGG + Intronic
1071859082 10:89654518-89654540 CCTTTATGTGTTCAGCAACCTGG - Intergenic
1071887457 10:89966593-89966615 CCTCCGTGTGTTCAGCAGTGAGG - Intergenic
1072289748 10:93952943-93952965 CCTCCATGTGTTCACCCACCTGG + Intronic
1072327296 10:94311143-94311165 CCTCGATGTGTTCACCAACCTGG + Intronic
1074975118 10:118573836-118573858 CCTTTGTGGGTACAGCTACCAGG + Intergenic
1075851626 10:125592958-125592980 CCTCCATGGGTTCAGCAACCTGG + Intronic
1076822050 10:132944255-132944277 CGTGGATGTGTTCAGCAACCTGG + Intergenic
1078152587 11:8772065-8772087 CCTTGATGTGTTCACCAACCCGG - Intronic
1078328479 11:10399138-10399160 CCTTCAGGTGTTCAGCTACCAGG + Intronic
1078346495 11:10554369-10554391 CCTCCATGTGTTCAGCCATCCGG - Intergenic
1078988948 11:16625747-16625769 CCTTCATGTGTTTACCAATCTGG - Intronic
1082263541 11:50096328-50096350 CCTCCTTGTGTTCAGCAACCTGG - Intergenic
1083707199 11:64524798-64524820 CCACCACGTGTTCAGCAACCCGG - Intergenic
1085260476 11:75201791-75201813 CCTCCATGTGTTCAGCTATCCGG + Intronic
1086956365 11:92938193-92938215 TCTCCATGTGTTCAGCAACCTGG - Intergenic
1086974235 11:93114445-93114467 CCCTGATGTGTTCACCAACCCGG + Intergenic
1087270608 11:96107809-96107831 CCCTCAGGTGTTCAGCAACCTGG - Intronic
1088095254 11:106092301-106092323 CCTGCTTGTGTCCAGCAAACGGG + Intronic
1088186169 11:107173808-107173830 CCTTCCTGTGCTTAGCAACAAGG + Intergenic
1088608669 11:111556298-111556320 CATCAGTGTGTTCACCAACCAGG + Intronic
1088617180 11:111642548-111642570 CCTCAGTGTGTTCAACAACTTGG + Intronic
1089078714 11:115759564-115759586 CCTTCGTCTTTTCTGCGACCAGG + Intergenic
1089105574 11:116000686-116000708 CCTTCATGTGTTCAACAGCCTGG + Intergenic
1090197947 11:124832985-124833007 CCTCCATGTGTTCAGCTATCTGG + Intergenic
1091162606 11:133438885-133438907 CCTTGATGTGTTCACCAACCTGG - Intronic
1091524352 12:1282995-1283017 CCTTCTTCTGTTCCACAACCAGG - Intronic
1093923888 12:24889950-24889972 CCTTCATGTGTTCTGCTATCCGG - Intronic
1094055836 12:26268887-26268909 CCTCCAAGTGTTCAGCAACCAGG + Intronic
1095469870 12:42525193-42525215 CCTCCATGTGTTCAGCTATCGGG - Intronic
1095786773 12:46118624-46118646 CCTCCATGTGTTCGCCAACCTGG - Intergenic
1097714637 12:62953902-62953924 CCTCCATGTGTTCAGCTATCTGG + Intergenic
1097729887 12:63116482-63116504 CCTCCATGTGTTCAGCTACCTGG + Intergenic
1100308259 12:93371061-93371083 CCTCCCTGTGTTCAGCTATCTGG + Intergenic
1103835462 12:123816453-123816475 CCTTGGTGTGGTTAACAACCTGG - Intronic
1104440830 12:128791983-128792005 CCCCCATGAGTTCAGCAACCAGG + Intergenic
1104715041 12:131010966-131010988 CCTTCATGTGCTCAGCAAAAGGG - Intronic
1105462526 13:20605948-20605970 CCTCCGTGTGTTCATCAACCTGG + Intronic
1106475736 13:30096548-30096570 CCTTCATGTGTTCAGCTCTCTGG + Intergenic
1106863684 13:33939406-33939428 CCTTGGTGTGTTCACCCACCTGG - Intronic
1110689292 13:78413081-78413103 CCTTCATGAGTTCAGCTATCTGG + Intergenic
1111209729 13:85062171-85062193 CCTCCATGTGCCCAGCAACCTGG + Intergenic
1111707617 13:91770249-91770271 TTTTCATATGTTCAGCAACCTGG + Intronic
1112183143 13:97104666-97104688 CCTCCGTGTGTTCACCAACCTGG + Intergenic
1113983632 13:114296411-114296433 CCTTGATGTGCTCACCAACCCGG - Intronic
1114378423 14:22174377-22174399 CCTCCATGTGTTCAGCTATCTGG + Intergenic
1115375066 14:32665523-32665545 CCTCCATGTGTTCAGCTATCTGG + Intronic
1116250481 14:42475498-42475520 GCTCCGGGTGGTCAGCAACCAGG - Intergenic
1116550343 14:46229614-46229636 CCTCCAGGTGTTCAGTAACCTGG + Intergenic
1117929775 14:60828968-60828990 CCTCCATGTGTTCAGCAACCTGG + Intronic
1119064487 14:71511884-71511906 CCTAAATGTGTTCACCAACCCGG - Intronic
1120957533 14:90096097-90096119 CATCCATGTGTTCAGCAATCTGG + Intronic
1121242129 14:92438718-92438740 CCTCCATGTGTTCAGCTATCAGG + Intronic
1124398160 15:29323374-29323396 CCTCCGTGTGTTCAGCTATCAGG - Intronic
1124716076 15:32063518-32063540 CATTGATGTGTTCACCAACCAGG + Intronic
1124898471 15:33799475-33799497 CCTTTGTGTGTTCAGCAACATGG - Intronic
1125394013 15:39227173-39227195 CCTCCTTGTGTTCAGCAACCTGG + Intergenic
1125476709 15:40052746-40052768 CATTGGTGTGTTCACCAACCAGG + Intergenic
1127635623 15:60866714-60866736 CCTCTATGTCTTCAGCAACCTGG - Intronic
1128176645 15:65562053-65562075 CCTCCGTGTGTTCAGCTGTCTGG + Intronic
1128461171 15:67868871-67868893 CCTGCATGTGTTCAGCTATCTGG - Intergenic
1128825358 15:70710812-70710834 CCTCCACATGTTCAGCAACCAGG + Intronic
1130043879 15:80429409-80429431 CCTCCATGTGTTCACCAACCGGG - Intronic
1132166269 15:99594409-99594431 CCTCCACGTGTTCAGCAATCTGG + Intronic
1132425203 15:101710166-101710188 CCTGGATGTGTTCAACAACCTGG - Intronic
1132919674 16:2380221-2380243 CCTCAGTGTATTCACCAACCCGG + Intergenic
1133154050 16:3859747-3859769 CCTCCATGTGTTCAGCTATCTGG - Intronic
1136114357 16:28085371-28085393 CCTCCACGTGTTCAGCAACCAGG - Intergenic
1137068722 16:35878708-35878730 CCTTCCTCTGTTCAAAAACCTGG + Intergenic
1137901393 16:52272891-52272913 CCTCCATGTGGTCAGCAACCTGG - Intergenic
1139017367 16:62706597-62706619 ACCTCATGTGTTCAGCTACCTGG + Intergenic
1139967080 16:70751686-70751708 CCTTCCTGGGTACAGCAGCCCGG - Intronic
1141300893 16:82814523-82814545 CCTCCATGGGTTCAGCAACCTGG - Intronic
1144405488 17:14949038-14949060 CCTCCATATGTTCACCAACCTGG - Intergenic
1146242811 17:31245730-31245752 CCTCTATGTGTTCGGCAACCTGG + Intronic
1147009593 17:37434419-37434441 CCTCCATGTGTTCAGCAGCCCGG + Intronic
1147176417 17:38658826-38658848 CCTTCCTGTCTTCTGCAACCTGG - Intergenic
1148927122 17:51097139-51097161 CCTCCATGTGTTCAGCTATCTGG - Intronic
1148983726 17:51602209-51602231 CCTCCATGTGTTCACCAACCTGG - Intergenic
1149170100 17:53799467-53799489 CCTTCATATGTTCAGCAACCTGG - Intergenic
1149426583 17:56560548-56560570 CCTCCATGTGTTCAGCTATCTGG - Intergenic
1150364772 17:64572680-64572702 CCTCAGTGTGTTCACCAACCTGG - Intronic
1150430446 17:65111584-65111606 CCTTGATGTGTTCACCAACCTGG + Intergenic
1150656341 17:67042207-67042229 CCTTGGTGAGGACAGCAACCAGG - Intergenic
1150837735 17:68579715-68579737 TCTTGGTGTGTTCATCAAGCTGG - Intronic
1151247674 17:72807631-72807653 CCTCCGTGTGTTCACCAACCTGG - Intronic
1152089781 17:78240115-78240137 CCTTCCTCTCTGCAGCAACCCGG + Exonic
1152406842 17:80102586-80102608 CCTTGGTGTGTTCCACAACCCGG - Intergenic
1152908031 17:82980727-82980749 CCTGCATGTGTTCAGCCATCTGG + Intronic
1153028210 18:690002-690024 CCTCCACGTGTTCACCAACCTGG - Intronic
1154243873 18:12678108-12678130 CCTTCCTGTGTTCTGACACCAGG + Exonic
1157833187 18:50876351-50876373 CCTTCACGTGTTCAGCAATCAGG - Intergenic
1158346484 18:56521516-56521538 CCTCCCTGTGTTCAGCAACAAGG + Intergenic
1158488987 18:57893278-57893300 CCTCCACCTGTTCAGCAACCTGG - Intergenic
1160027824 18:75233047-75233069 CCTGCCTGTGTCCAGCAGCCTGG + Intronic
1165223781 19:34339472-34339494 CCTTAGTGTGTTCACCAGCGTGG + Intronic
1166920044 19:46222997-46223019 CCTCCATGTGTTCAGCAGCCAGG + Intergenic
925616930 2:5752562-5752584 CCTTCCTCTGTGCAGCAGCCAGG - Intergenic
926367492 2:12146399-12146421 CCTCCACGTGTTCAGCAGCCTGG + Intergenic
929868867 2:45741226-45741248 CCTTTGTATGTTCAGCAATGAGG + Intronic
931438962 2:62273801-62273823 CCTCCATGTGTTCAGCAACGGGG - Intergenic
932602615 2:73138902-73138924 CCTTAATGTGTTCACCAACCTGG + Intronic
933270663 2:80229575-80229597 CCTCTAAGTGTTCAGCAACCTGG + Intronic
935149517 2:100421118-100421140 CCTGAATGTGTTCACCAACCTGG - Intergenic
935245640 2:101216708-101216730 CCTCCATGTGTTCAGCTATCTGG + Intronic
936473246 2:112817203-112817225 CCTTCATGTGTCCAGCTATCTGG + Intergenic
936480640 2:112881795-112881817 CCTTCCTGTTTACAGGAACCTGG - Intergenic
936595118 2:113840269-113840291 CCTCCGTGTGTTCAGCTATCTGG - Intergenic
938739055 2:134213839-134213861 CATGGTTGTGTTCAGCAACCTGG + Intronic
938884149 2:135625796-135625818 CCTCCATGTGTTCAGCTATCGGG - Intronic
939575181 2:143887053-143887075 CCTTCATGTGTTCAGCTATCTGG - Intergenic
939612391 2:144327161-144327183 CCTCCATGTGTTCAGTTACCTGG - Intronic
940190668 2:151037147-151037169 CCTCCATGTGTTCAGCAACCTGG - Intronic
940556282 2:155232815-155232837 CCTCCATGTTTTCACCAACCTGG + Intergenic
942743257 2:179203462-179203484 CCTTGATGTGTTCACCCACCTGG - Intronic
944146117 2:196509306-196509328 CCTCCATGTGTTCAGCTATCTGG + Intronic
944277985 2:197861309-197861331 CCTTCATGTGGTCAGCTATCTGG - Intronic
944554255 2:200872349-200872371 TCTACTTGTGTTCACCAACCTGG + Intronic
945094209 2:206203529-206203551 CCTCCGTGTGTTCACCAGACCGG - Intronic
945951357 2:216041844-216041866 CCTTCATGTGTTCAGCTATCTGG - Intronic
946177789 2:217932193-217932215 TCTTAGTGTGTTCAGGAATCTGG - Intronic
946743780 2:222826173-222826195 CCTCCATGTGTTCAGCTATCTGG + Intergenic
947755402 2:232560077-232560099 CCTCCATGTGTTCAGCTATCTGG - Intronic
948468213 2:238162203-238162225 CCATCGTGTGTTCAGATCCCAGG - Intronic
1170230658 20:14043454-14043476 CCTTTATGTGTTCAGCTATCTGG + Intronic
1170269094 20:14503742-14503764 CTTTGGTGTGTTCAGCATCTAGG - Intronic
1170687812 20:18585227-18585249 CATCAATGTGTTCAGCAACCAGG + Intronic
1170724506 20:18914475-18914497 CCTCCATGTGTTCAGCTATCTGG - Intergenic
1171083865 20:22217877-22217899 CCTGTGTGTGTTCTGCAATCTGG - Intergenic
1171480258 20:25449896-25449918 CCTCCATATGTTCAGCAATCCGG + Intronic
1172031209 20:31983527-31983549 GCTTGGTGTGTTCAGGAAGCAGG + Intronic
1172162912 20:32880756-32880778 CCTCCGTGTGTTCAGCCATAGGG + Intronic
1174307811 20:49626924-49626946 CCTCCGTGTGTTCAGCTATCTGG + Intergenic
1174567726 20:51478824-51478846 CCTTGGTGTGTTCAGGGAACAGG - Intronic
1177260148 21:18719419-18719441 CCTCAGTGTGTTCACCCACCTGG - Intergenic
1177322784 21:19544238-19544260 CTTACATGTGTTCAGTAACCTGG - Intergenic
1177830598 21:26134591-26134613 CCTCCATGTGTTCAGCTATCTGG + Intronic
1180023767 21:45146683-45146705 CGTGAGTGTGTCCAGCAACCAGG + Intronic
1180051774 21:45334986-45335008 CCTTCGTGTTTTCTGCCATCAGG + Intergenic
1182052820 22:27326034-27326056 CCTGCATGTGTTCAGCTATCTGG - Intergenic
1182622350 22:31625112-31625134 CCTTGGTTTGCTCAGCAACTGGG - Intronic
1182663335 22:31940704-31940726 CACACGTGTGTTCAGGAACCCGG + Intronic
1184341897 22:43890856-43890878 CCCTTCTGTGTGCAGCAACCTGG + Intronic
1184429709 22:44434792-44434814 CCTCCTTGTGTTCAGCTATCTGG - Intergenic
950088382 3:10277628-10277650 CATTGGTGTGTGCAGCAGCCAGG - Intronic
951221723 3:20075755-20075777 CCTCCACATGTTCAGCAACCTGG + Intronic
951993846 3:28705078-28705100 CCTCCATGTGTTCAGCCATCTGG + Intergenic
952218892 3:31304542-31304564 CCTCAATGTGTTCACCAACCTGG + Intergenic
952309601 3:32176280-32176302 CCTCCATGTGTTCAGCTATCCGG + Intergenic
953169425 3:40493896-40493918 CCTCCATGTGTTCACAAACCTGG - Intergenic
956523715 3:70133336-70133358 CCTGCATGTGTTCAGCAGCTCGG - Intergenic
959113020 3:102144430-102144452 CCTCCATGAGTTCAGCAATCTGG - Intronic
961431006 3:126883100-126883122 CCTCCAAGTGTTCAGCTACCTGG - Intronic
961813912 3:129538086-129538108 CTGTCTTGTGTTGAGCAACCAGG - Intergenic
965843996 3:172940026-172940048 CCATGATGTGTTCACCAACCTGG - Intronic
966712779 3:182986584-182986606 CCTCCACGTGTTCAGCAATCAGG - Intergenic
966751677 3:183328117-183328139 CCTTGGTGTATTCACCAACCTGG - Intronic
967279656 3:187809604-187809626 CCTTTGTGTGTTCCCCAAACTGG - Intergenic
967710312 3:192699272-192699294 CCTTAGTGTTTTCTGCAACAAGG + Intronic
967910904 3:194541810-194541832 CCTCCATGTGTTCAGCTATCCGG - Intergenic
967963371 3:194942371-194942393 CATCAGTGTGTTCACCAACCCGG - Intergenic
969711346 4:8846071-8846093 CCTTAGTGTGTGCACCCACCTGG - Intronic
971586950 4:28416357-28416379 CATTGCTGTGTTCACCAACCTGG - Intergenic
973191011 4:47386005-47386027 CCTTGATGTGTTCACCAGCCTGG + Intronic
975446161 4:74467999-74468021 CCTTCATGTGTTCGGCTACCAGG - Intergenic
975491092 4:74989533-74989555 CCTCCCTGTGTTCAGCTATCAGG + Intronic
976703260 4:87993913-87993935 CCTTGATTTGTTCACCAACCTGG + Intergenic
976789617 4:88863318-88863340 CCTCCATGTATTCACCAACCTGG - Intronic
976808136 4:89071337-89071359 CCACCATGTGTTCACCAACCTGG - Intronic
978335766 4:107667203-107667225 CCTCCGTGTGCTCACCAACTGGG - Intronic
978943756 4:114470000-114470022 CCTTCACGTGTTCAGCAACCTGG - Intergenic
979559337 4:122084375-122084397 CCTTGATGTGTTCACCAACGTGG - Intergenic
981207879 4:142065934-142065956 CCTTCATGTGTTCAGCTATCTGG + Intronic
981704873 4:147648388-147648410 CCTCCATGTGTTCAGCTACCTGG - Intronic
983079993 4:163372986-163373008 CCTCCATGTGTTCAGCTATCTGG + Intergenic
983626269 4:169804844-169804866 CCTTAATGTGTTCACCAACCAGG - Intergenic
984232465 4:177115426-177115448 CCTCCATGTGTTCAGCTATCTGG - Intergenic
984789906 4:183605850-183605872 CCTCCATGAGCTCAGCAACCTGG + Intergenic
987717578 5:21592328-21592350 CCTCCATGTGTTTAGCAACCCGG - Intergenic
989251407 5:39319744-39319766 CCTTCATGAGTTCAGCCTCCAGG + Intronic
990604556 5:57395764-57395786 CCTCCATGTGTTCAGCGCCCCGG + Intergenic
990866716 5:60388137-60388159 CCTTCACGTGTTCAGCTATCTGG + Intronic
990867449 5:60395929-60395951 CCTTTGTGTGGTAAACAACCTGG - Intronic
991013650 5:61909910-61909932 CCTTGGGGTGATCAGCTACCTGG - Intergenic
991033691 5:62106901-62106923 CCTTGGGGTGATCAGCTACCTGG + Intergenic
991947214 5:71910842-71910864 CTCTAATGTGTTCAGCAACCTGG - Intergenic
993210984 5:84951108-84951130 CTTCCATGTGTTCAGCAACTTGG - Intergenic
996273527 5:121637453-121637475 CGTTAATGTGTTCACCAACCTGG + Intergenic
996568792 5:124910077-124910099 CCTCCACGTGTTTAGCAACCTGG - Intergenic
997394584 5:133547998-133548020 CATCAGTGTGTTCACCAACCAGG - Intronic
998620830 5:143792582-143792604 CATTCTTGTGTTCAGCATACGGG - Intergenic
1000595302 5:163208746-163208768 CCTTCATGTGTTCAGCAATCTGG + Intergenic
1000848037 5:166305553-166305575 CCTCTATGTGTTCAGCAACCTGG + Intergenic
1001866410 5:175109566-175109588 CGTTAATGTGTTCACCAACCAGG + Intergenic
1003348631 6:5294795-5294817 CCTTCGTGTGTTCAGCTATCAGG + Intronic
1004832274 6:19490016-19490038 CCTCCATGTGTTCAGCTATCTGG - Intergenic
1004836417 6:19536834-19536856 CTGCAGTGTGTTCAGCAACCAGG - Intergenic
1004931684 6:20468503-20468525 CCTCCTTGTGTTCAGCTACCTGG + Intronic
1006087957 6:31609995-31610017 CCTCCATGTGTTCATCAACCTGG - Intergenic
1007741942 6:44016924-44016946 CCACCATGTGTTCAGCAATCTGG - Intergenic
1010180540 6:73081902-73081924 CCTTCGTGTGTTTAGCATTCAGG - Intronic
1010765329 6:79772156-79772178 CCTCAGTGTGTTCACCAACCTGG + Intergenic
1013074952 6:106763185-106763207 CCTTAATGTGTTCAGCTATCTGG - Intergenic
1014074656 6:117222360-117222382 CCTTGATGTGTTCACCAACCTGG + Intergenic
1015286443 6:131490782-131490804 CCTCCATCTGTTCACCAACCTGG - Intergenic
1016440028 6:144073875-144073897 CCTCAGTGTGTTCAGCTACCTGG - Intergenic
1016543004 6:145187783-145187805 CCTTCAGGAGTTCAGCAACCTGG + Intergenic
1018195558 6:161353515-161353537 CCTCCATGTGTTCAGCAACCTGG - Intronic
1018759818 6:166884248-166884270 CCTTGATGTGTTCACCAACCTGG - Intronic
1021918927 7:25464330-25464352 CCTTGATGTGTTCACCAATCCGG + Intergenic
1026015659 7:66669033-66669055 CCTCCCTGGGCTCAGCAACCCGG + Intronic
1029960761 7:104687322-104687344 ACTTCATGTGTTCAGCTATCTGG + Intronic
1031368034 7:120927305-120927327 CCTTGATATGTTCACCAACCTGG - Intergenic
1031568049 7:123323590-123323612 CCTTGATGTTTTCAGCAATCTGG + Intergenic
1032431776 7:131867988-131868010 CCTCCATGTGTTCAGCTATCAGG + Intergenic
1032729860 7:134629836-134629858 TCTTGATGTGTTCACCAACCTGG - Intergenic
1033098481 7:138450797-138450819 CCTCCATGTGTTCATCAACCTGG - Intergenic
1034482414 7:151332733-151332755 CCTTCATGTGTTCAGCTATCTGG - Intergenic
1034866195 7:154644560-154644582 TCTCCGTGTGTGCAGCAGCCAGG - Intronic
1035785827 8:2260039-2260061 CCTTCGTGTGGTCTCCAGCCTGG + Intergenic
1035806980 8:2461677-2461699 CCTTCGTGTGGTCTCCAGCCTGG - Intergenic
1036392008 8:8331741-8331763 CCTTCGTGTATTCAGGCAGCTGG + Intronic
1037583321 8:20259632-20259654 ACTTCGTATGTTCACCCACCAGG - Intronic
1039488898 8:37932809-37932831 CCTCCATATGTTCAGCAACCTGG - Intergenic
1039536923 8:38324874-38324896 CCTTCGTGTGTTCAGCAACCTGG - Intronic
1042096156 8:65218008-65218030 CCTCCACGTGTTCAGCAATCTGG - Intergenic
1042346179 8:67730410-67730432 CTTCCATATGTTCAGCAACCTGG + Intronic
1043654550 8:82645975-82645997 CCTCCGTGTGTTCAGCTATAAGG + Intergenic
1043913287 8:85890139-85890161 CTTTGGTGTGTTCACCAACCAGG - Intergenic
1044325223 8:90851110-90851132 CCTGCATGTGTTCACAAACCTGG - Intronic
1044606492 8:94052459-94052481 CCCTTATGTGTTCACCAACCAGG + Intergenic
1044606734 8:94054341-94054363 CCTCCACGTGTTCAGCTACCCGG + Intergenic
1045347859 8:101310763-101310785 CCTCCATGTGTTCAGCAATCCGG + Intergenic
1045517432 8:102872402-102872424 CCTCCATGTGTTCAGCTATCTGG + Intronic
1045996645 8:108370292-108370314 CCTTCATGTGTTCAGCTATCTGG - Intronic
1049429728 8:142555172-142555194 CCTGCGTGTGTTCAGCTATCTGG - Intergenic
1052614926 9:30825942-30825964 CCTCCATGTGTTCAGCTATCTGG + Intergenic
1053123541 9:35562506-35562528 CTTTCCTGTGCTCACCAACCAGG - Exonic
1053143949 9:35699356-35699378 CCTTCATGGCTTCAGCAGCCTGG + Exonic
1054710458 9:68505706-68505728 CCTTGATGTGTTCACCAGCCTGG + Intronic
1055118819 9:72634929-72634951 CCTCCATGTGTTCAGCAACCTGG + Intronic
1057469481 9:95344798-95344820 CCTCCATGTGTTCAGCTATCAGG + Intergenic
1057666594 9:97050742-97050764 CCTCCGTGTGTTCAGCCATCTGG - Intergenic
1057699873 9:97356023-97356045 CCTTTCTGTGGTCAGCAGCCAGG - Intronic
1062609595 9:137368108-137368130 CCTTCCCGTGTTCAGCCACGTGG + Intronic
1186265997 X:7834370-7834392 CCTTGGTGTTTTCAGGAAACAGG - Intergenic
1190955598 X:55189908-55189930 CCTCCATGTGTTCAGCTAGCTGG + Intronic
1192106333 X:68321011-68321033 CCTTCATGTGTTCATCTATCTGG + Intronic
1196286075 X:113882018-113882040 CCTCAGTGTGTTCACCAACCGGG + Intergenic
1196602115 X:117613817-117613839 CGTATGTGTGTTCAGCATCCAGG + Intergenic
1196884083 X:120226228-120226250 CCTCTGTGTGTTCAGCAATCTGG + Intergenic
1197787199 X:130210785-130210807 CCTTCCTGTGTTAGACAACCAGG + Intronic
1198256962 X:134932355-134932377 CCTTTATGTGTTCAGCTATCGGG + Intergenic
1198962450 X:142196366-142196388 CCATCATCTGTTCAGCAGCCCGG + Intergenic
1199186820 X:144924985-144925007 CCTGGGTGTGTTCGGCAACTTGG - Intergenic