ID: 1039536932

View in Genome Browser
Species Human (GRCh38)
Location 8:38324908-38324930
Sequence TGGCATGGCCAGAGAGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039536923_1039536932 11 Left 1039536923 8:38324874-38324896 CCAGGTTGCTGAACACACGAAGG 0: 1
1: 0
2: 17
3: 70
4: 215
Right 1039536932 8:38324908-38324930 TGGCATGGCCAGAGAGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039536932 Original CRISPR TGGCATGGCCAGAGAGGGCA TGG Intronic
No off target data available for this crispr