ID: 1039539116

View in Genome Browser
Species Human (GRCh38)
Location 8:38348095-38348117
Sequence GCGGAGTCAATGAGTTGAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039539113_1039539116 -6 Left 1039539113 8:38348078-38348100 CCTCCTGACGGATGTTGGCGGAG 0: 1
1: 1
2: 0
3: 4
4: 28
Right 1039539116 8:38348095-38348117 GCGGAGTCAATGAGTTGAGGTGG 0: 1
1: 1
2: 0
3: 9
4: 68
1039539114_1039539116 -9 Left 1039539114 8:38348081-38348103 CCTGACGGATGTTGGCGGAGTCA 0: 1
1: 1
2: 0
3: 2
4: 24
Right 1039539116 8:38348095-38348117 GCGGAGTCAATGAGTTGAGGTGG 0: 1
1: 1
2: 0
3: 9
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039539116 Original CRISPR GCGGAGTCAATGAGTTGAGG TGG Exonic
901347242 1:8556419-8556441 GAGGAGTCACTGAGTGCAGGAGG - Intronic
904356623 1:29944451-29944473 GCAGAGTCAGTGAGGTGTGGTGG - Intergenic
905207742 1:36352566-36352588 GCTGAGTGAGTGAGTTGAGGAGG - Intronic
905317830 1:37094857-37094879 GAGGAGCTAATGAGTTGGGGAGG - Intergenic
906318600 1:44803400-44803422 GGGGTGTCAGTGGGTTGAGGGGG + Intronic
909013784 1:70362298-70362320 GCTGAGTCAATGAGATGAAAAGG + Intronic
912162817 1:107007012-107007034 GGGGAGTCAAAGATTAGAGGAGG - Intergenic
917742589 1:177975444-177975466 GCTGAGGCAGTGAGTTTAGGGGG + Intronic
923003105 1:230023773-230023795 GAGGAGTTAGTGAGTTGAGTAGG + Intergenic
923349512 1:233089898-233089920 GCTGAGTCAATGAACTGAGGAGG + Intronic
923946695 1:238896022-238896044 GAGGAGTCAGTGAAGTGAGGGGG - Intergenic
1062861698 10:815450-815472 GCGGTGTGAATGAGTTGTGTTGG - Intronic
1065018061 10:21479619-21479641 GAGGGGGCAATGAGTAGAGGTGG + Intergenic
1066048761 10:31617152-31617174 GGGGTGTCACTCAGTTGAGGAGG + Intergenic
1073546451 10:104353613-104353635 GCGGAGCCAAGGAAGTGAGGGGG - Intergenic
1077183945 11:1228275-1228297 GCGGAGCCAAGGAGGGGAGGTGG - Intronic
1078267601 11:9766589-9766611 GAGGAGTCCATGATTTCAGGAGG - Intergenic
1081952561 11:47057623-47057645 GCAGTGTTATTGAGTTGAGGAGG + Intronic
1085165755 11:74398194-74398216 GCGAAGACACTGAGTTGGGGTGG + Exonic
1089875714 11:121719899-121719921 GAGCAGTCAATGAGGTAAGGAGG - Intergenic
1090444403 11:126751181-126751203 GTGGATTGAATGAGCTGAGGGGG - Intronic
1090806260 11:130204210-130204232 GTTGAGTGAATGAGTTGATGGGG + Intronic
1092509039 12:9134250-9134272 CCGGAGTCAAGCACTTGAGGTGG - Intergenic
1095148643 12:38763263-38763285 GCAGAGTAAATGGGTTGATGTGG + Intronic
1101013370 12:100473911-100473933 GGGGAGACAATGAGGTGAGGAGG - Intronic
1104102324 12:125624348-125624370 GCAGAGTAAATGAGATGAAGTGG - Intronic
1113238757 13:108313392-108313414 CAGGAGTCCATGAGATGAGGAGG + Intergenic
1129811919 15:78518085-78518107 GAGGACTCTCTGAGTTGAGGAGG - Intronic
1130756479 15:86769817-86769839 AGGGAGGCAATGAGATGAGGTGG - Intronic
1132821217 16:1872186-1872208 GCGGAGTCAGTGAGCGGTGGGGG - Intronic
1139345138 16:66298017-66298039 TCTGAGTCAATCAGTTGAGAGGG - Intergenic
1139660330 16:68416405-68416427 GCGGTGGCAATGATTTGTGGAGG - Intronic
1142830466 17:2545384-2545406 GCAGAGGCAATGAGTGGGGGAGG - Intergenic
1147891437 17:43720360-43720382 GCGGAGTCAGTGAGTTGAGGTGG + Intergenic
1149424510 17:56542244-56542266 GAGGAATGAATGACTTGAGGTGG - Intergenic
1150719255 17:67600228-67600250 GAGGAGTCAGGGAGTGGAGGTGG + Intronic
1156068616 18:33176306-33176328 GGTGTGTCAATGAGTTCAGGGGG - Intronic
1156483526 18:37450697-37450719 GGGGAGCCCATGAGGTGAGGCGG - Intronic
1158610109 18:58931973-58931995 ATGGAGTCAAGGAGTAGAGGAGG + Intronic
1163489649 19:17609693-17609715 GGGGAGGCAATGAGTAGAGTGGG - Intronic
1163645473 19:18486668-18486690 GAGCAGACAATGAGATGAGGCGG - Intronic
1167162620 19:47778231-47778253 GAGGAGACAGGGAGTTGAGGGGG - Intergenic
925328910 2:3043250-3043272 GCTAAGTTAATGAGCTGAGGAGG - Intergenic
937518392 2:122681849-122681871 GCAGAGTAAATGACTTCAGGTGG + Intergenic
942816790 2:180061423-180061445 GCGGAGTCAAAGGATTGAGCGGG - Intergenic
945234032 2:207617885-207617907 GGGGAGTCAAGGAGTTGGGTGGG + Intronic
948856256 2:240731978-240732000 GAGGAGCCAATGAGGGGAGGAGG + Intronic
1169750495 20:8987809-8987831 GGGGAGCAAATGAGTAGAGGTGG - Intergenic
1178284217 21:31311564-31311586 GAGCAGTCCATGAATTGAGGGGG + Intronic
1178903358 21:36615479-36615501 GCGGAGTGCATGAGCTGTGGGGG - Intergenic
1183130834 22:35834282-35834304 GAGGATTCAATGAGTTAATGAGG + Intronic
953060143 3:39420729-39420751 GCTGAGTCACTGAGGAGAGGTGG - Intergenic
960846900 3:122012366-122012388 GAGGAGTCAATGAACTGGGGAGG - Intronic
960997691 3:123350697-123350719 TCGGAGCCAATGTGCTGAGGAGG - Intronic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
965886902 3:173457133-173457155 GGGTGGTGAATGAGTTGAGGAGG + Intronic
967198417 3:187049556-187049578 GCGGAGACCCTGAGCTGAGGAGG - Intronic
967787681 3:193514960-193514982 GCAGAGTGAAGGAGTTGAGGAGG + Intronic
968288997 3:197524690-197524712 GTTGAGGCAATGAGTTGGGGTGG + Intronic
995005313 5:107186073-107186095 GCAGACCCAATTAGTTGAGGAGG + Intergenic
995892614 5:116972566-116972588 GCGGTCTCACTGAGTTGAGGAGG + Intergenic
998148865 5:139745916-139745938 GCTGATTCAATGGTTTGAGGGGG - Intergenic
1001658883 5:173375465-173375487 GCGGAGTCAATGTGTGCAGGAGG + Intergenic
1002912504 6:1501139-1501161 GTGGAGTGAAAGAGGTGAGGGGG + Intergenic
1005726294 6:28652038-28652060 GTGTAGTGAATGAGTTGAGGTGG + Intergenic
1013359223 6:109378457-109378479 GCGGAGACAGTAAGTTGAAGTGG + Intronic
1015734962 6:136389359-136389381 GCGGAGGCAGAGACTTGAGGAGG - Exonic
1017550677 6:155503860-155503882 AGAGAGTCAATGAGTTGAAGAGG - Intergenic
1019145350 6:169972286-169972308 GCGGAGTCCCTGAGATGAGGGGG - Intergenic
1028288313 7:89032322-89032344 GGGGAGAGAATGAGTTAAGGGGG + Intronic
1031850818 7:126860253-126860275 ACGAAGTCAGAGAGTTGAGGAGG - Intronic
1039539116 8:38348095-38348117 GCGGAGTCAATGAGTTGAGGTGG + Exonic
1045443765 8:102239476-102239498 GCGGGGCCGATGAGGTGAGGTGG - Intergenic
1045663097 8:104458330-104458352 GTGGAGTGAATGAGTTGAGAGGG - Intronic
1047772972 8:128045253-128045275 GAGGAGTCAAGGAGTAGAGTTGG - Intergenic
1048229312 8:132621322-132621344 GGGGTGACAATGAGTTGAAGTGG + Intronic
1187312650 X:18160491-18160513 GTGGTGACACTGAGTTGAGGCGG + Intergenic
1189348268 X:40258845-40258867 GTGGATTAAAGGAGTTGAGGTGG - Intergenic
1197762239 X:130036120-130036142 GCTGGGTGAATGAGGTGAGGAGG - Intronic