ID: 1039540004

View in Genome Browser
Species Human (GRCh38)
Location 8:38358424-38358446
Sequence CTATGGAAACACATTGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039540004 Original CRISPR CTATGGAAACACATTGAGTG TGG (reversed) Intronic
905102567 1:35538067-35538089 CTATGGGAACACAAAGAATGGGG - Intronic
905292853 1:36934722-36934744 CAATGGAAACACATTTAATGTGG + Intronic
907869103 1:58426847-58426869 CTATGGAAAAAAATTAAGTCAGG + Intronic
908152616 1:61318815-61318837 CTATGCAAATACCTTGAGTCGGG - Intronic
911332753 1:96544020-96544042 CTATGGACACACCTTGTGTGTGG + Intergenic
917292700 1:173487712-173487734 CTATTGAAAGACATTGAGAATGG - Intronic
917472502 1:175337611-175337633 GAATGGAGACACTTTGAGTGGGG - Exonic
919442548 1:197655088-197655110 CTATGGAAAAATTTAGAGTGAGG + Intronic
920779406 1:208974099-208974121 CTAAGGAAGCACAGTGAGGGAGG + Intergenic
1064133474 10:12730493-12730515 CTATAGATACACATTGGGGGTGG + Intronic
1064893277 10:20204724-20204746 ATGTGTAAACACATTGGGTGTGG - Intronic
1065295471 10:24270329-24270351 TTATGGAAACCCAGTAAGTGGGG - Intronic
1066747895 10:38620205-38620227 CTATGGAATCACAATGAGGAAGG - Intergenic
1070334883 10:75446469-75446491 ATATGCAAACACATTATGTGTGG - Intronic
1073893937 10:108132295-108132317 ACATGGACACACATGGAGTGAGG + Intergenic
1075143461 10:119862367-119862389 CTAAGGACACACATGGAGTCTGG - Intronic
1078251483 11:9620171-9620193 ATCTGGAAACACAAAGAGTGGGG + Intergenic
1080118929 11:28652743-28652765 GTATGGAAAGACAATGAATGAGG - Intergenic
1081194018 11:40139278-40139300 CTATGGAAACCCCTTAAGTTAGG + Intronic
1083585524 11:63855758-63855780 TTATGAAAACACATTGAATGTGG + Intronic
1084964363 11:72736731-72736753 CCATGGAAAGGCTTTGAGTGGGG - Intronic
1085307845 11:75498355-75498377 CTATGGAAACACAGAGTGGGTGG + Intronic
1088579940 11:111305551-111305573 CTACGGTGACACATTTAGTGGGG - Intronic
1089315684 11:117589420-117589442 TAATGAAAACACATTGAGTTGGG - Intronic
1091098725 11:132849527-132849549 CTATGGAGACAAATCAAGTGGGG + Intronic
1091843766 12:3638933-3638955 CTAAGGACACACAGTGAGTAAGG - Intronic
1098729975 12:74023763-74023785 CTATGGAAACCCATATAGTACGG - Intergenic
1100124012 12:91401725-91401747 CTTTGGATTCATATTGAGTGTGG + Intergenic
1100564693 12:95783979-95784001 CATTGGAAACAAATTGAGTCTGG + Intronic
1104522255 12:129486598-129486620 CCCTGGACACACAATGAGTGGGG - Intronic
1107204373 13:37764056-37764078 CTATGGAATCTCATTGCTTGGGG - Intronic
1107909253 13:45089742-45089764 CAATGGAAATAAATTGAATGTGG + Intergenic
1110889760 13:80684417-80684439 CTGTGGCAACATATTGACTGGGG + Intergenic
1111024564 13:82502538-82502560 ATGTGGACACACAATGAGTGAGG + Intergenic
1115816039 14:37165598-37165620 CTATGGAAGAAAATTCAGTGTGG + Intronic
1116148659 14:41108370-41108392 CAATGGATACACATTCACTGGGG + Intergenic
1117793749 14:59369113-59369135 GTATGCATTCACATTGAGTGTGG + Exonic
1119771727 14:77224363-77224385 CTCTGGAACCACATGGACTGGGG - Intronic
1121282840 14:92711649-92711671 GTATGGAAACAAAGTGAGTCGGG - Exonic
1121556118 14:94839083-94839105 CTATGGAAACACTGTGCGGGAGG + Intergenic
1121737871 14:96231216-96231238 TTCTGGAAACACTTTCAGTGGGG - Intronic
1122385393 14:101341843-101341865 CTTTGGAAACTGATTCAGTGTGG - Intergenic
1125422582 15:39519456-39519478 TCCTGGAAACAAATTGAGTGGGG + Intergenic
1128796663 15:70471300-70471322 GTCTGCAAACAGATTGAGTGGGG - Intergenic
1129110873 15:73336293-73336315 CTCTGGAAGCACCCTGAGTGGGG + Intronic
1131775656 15:95795146-95795168 CTATGCAAATTCATTGGGTGGGG + Intergenic
1132215813 15:100060930-100060952 CTTTAGAAACATAATGAGTGTGG + Intronic
1136734867 16:32457095-32457117 CTATGGAATCACAATGAGGAAGG + Intergenic
1140977522 16:80074301-80074323 CTATGCAAACCCATTTCGTGGGG + Intergenic
1141123691 16:81384655-81384677 CTGAGGAAACACTTTAAGTGAGG - Exonic
1203018211 16_KI270728v1_random:372498-372520 CTATGGAATCACAATGAGGAAGG - Intergenic
1203036546 16_KI270728v1_random:645656-645678 CTATGGAATCACAATGAGGAAGG - Intergenic
1149030632 17:52078912-52078934 ATATGGAAACAGATAGTGTGGGG - Intronic
1150104583 17:62452899-62452921 CTCTGAAAACCCATTAAGTGGGG - Intergenic
1154332131 18:13438826-13438848 GGATGGAAACAGCTTGAGTGAGG + Intronic
1157418935 18:47528991-47529013 TTTTAAAAACACATTGAGTGTGG + Intergenic
1167449340 19:49557729-49557751 CTATGGACGGACAGTGAGTGAGG + Intronic
1167535711 19:50050114-50050136 CTCTGGCAACACTTTGTGTGCGG + Intronic
925217388 2:2109137-2109159 GTATGGGAACACCTTGATTGTGG + Intronic
925485547 2:4325403-4325425 CTATGGAAGGACATTCAATGGGG - Intergenic
929860581 2:45673878-45673900 CTATGGAATTACATTGGCTGAGG + Intronic
929937112 2:46300998-46301020 CAATGGAAACATATCAAGTGTGG - Intronic
930959982 2:57250193-57250215 AATTGGTAACACATTGAGTGAGG + Intergenic
933639375 2:84742840-84742862 CTAAGTAAACCCATTAAGTGTGG + Intronic
934310860 2:91862351-91862373 CTATGGAATCACAATGAGGAAGG - Intergenic
935619134 2:105113384-105113406 CTATGAAAATACGTAGAGTGAGG + Intergenic
942831532 2:180242181-180242203 CTAAAGAAACACATTGAAGGTGG + Intergenic
943135908 2:183912801-183912823 CAATGGAAATAGATTAAGTGGGG - Intergenic
944136784 2:196408266-196408288 TAATGGAAAAACATTGAATGAGG + Intronic
944902289 2:204227972-204227994 TAATAGAAACCCATTGAGTGAGG + Intergenic
947841442 2:233210263-233210285 CTATGGGAACAGATAGAATGGGG + Intronic
1170819973 20:19748800-19748822 CAAGGGAAACACATTGAATGGGG + Intergenic
1171157377 20:22888780-22888802 CAATGGAAACAGATTGGGGGTGG + Intergenic
1175617349 20:60411957-60411979 CTATGGAAACTCATACACTGTGG - Intergenic
1176196380 20:63838063-63838085 CTATGCACACACCATGAGTGAGG + Intergenic
1177711512 21:24781655-24781677 CTTTGGAAAAATATTTAGTGTGG + Intergenic
1180537616 22:16408281-16408303 CTATGGAATCACAATGAGGAAGG - Intergenic
1180939121 22:19645332-19645354 GAATGAAAACACTTTGAGTGAGG - Intergenic
1182722231 22:32412471-32412493 TTATGAAAACACCTTGAGTCTGG + Intergenic
1183002610 22:34874276-34874298 CAAAGGACAAACATTGAGTGAGG + Intergenic
1185091456 22:48777933-48777955 CTTTGGAAACCAAGTGAGTGTGG + Intronic
950883582 3:16343788-16343810 CTATGCAAACTCCTTGAGTCAGG - Intronic
954160641 3:48719097-48719119 CTATGGAAACATATAGAGCCAGG - Intronic
955100838 3:55848235-55848257 ATATGGAAACAGATTGACTTTGG - Intronic
958491185 3:94775802-94775824 TTAAGCCAACACATTGAGTGTGG + Intergenic
958887807 3:99747558-99747580 CTTTGGAAATAAATAGAGTGGGG + Intronic
959134066 3:102394808-102394830 ATATGGAAAGAAATTGAGAGTGG + Intronic
959670723 3:108973974-108973996 TTATGGAAACTCTTTGATTGAGG + Intronic
960089398 3:113623803-113623825 CTGTGAAAACACATTAAGAGAGG - Intronic
961072382 3:123945434-123945456 ATATGGCAAAATATTGAGTGAGG + Intronic
962275977 3:134013774-134013796 ATTTGGAAACACATAGATTGTGG + Intronic
962864849 3:139439718-139439740 CAATGGAAAAACTTTGAGTAGGG - Intergenic
964882713 3:161442176-161442198 ATATCCATACACATTGAGTGGGG - Intergenic
965151759 3:164986490-164986512 TAATGGAAACAGATTGAGTGAGG - Intronic
965555245 3:170011751-170011773 ATATGGGAACAGATTGAATGCGG + Intergenic
967349300 3:188494361-188494383 CGATGAAAACACAATGAGGGAGG - Intronic
967875089 3:194263158-194263180 CTATGACAACCCTTTGAGTGAGG + Intergenic
971252378 4:24984197-24984219 GTAGGGAAACACAACGAGTGAGG + Intergenic
971825435 4:31615231-31615253 TAATGTAAACACCTTGAGTGGGG + Intergenic
972277136 4:37568009-37568031 ATGTGGAAACACATTCAATGTGG - Intronic
972292237 4:37700001-37700023 CTATGTCAACACATTTACTGAGG - Intergenic
977008357 4:91602196-91602218 CTTTGTAAACACTTTAAGTGGGG - Intergenic
977944019 4:102890301-102890323 CTATGGAATCACAATGAGGAAGG - Intronic
979547604 4:121955170-121955192 TTTTCAAAACACATTGAGTGAGG - Intergenic
980152571 4:129065600-129065622 CTAATGAAACACATAGCGTGTGG + Intronic
981780914 4:148427831-148427853 CAATGGAAGCCCATTGAGAGTGG - Intronic
982780364 4:159483974-159483996 TTATGGAAACATATTGTGAGTGG + Intergenic
984052225 4:174878189-174878211 CTAAGTAAACACCTTGAGTTTGG + Intronic
986212691 5:5689261-5689283 ACATGGAACCACATGGAGTGAGG + Intergenic
986268501 5:6211120-6211142 ACATGGAAACACATGGAGTGAGG + Intergenic
988342789 5:29996202-29996224 AAATTGAAACACATTGAATGTGG - Intergenic
990561817 5:56991055-56991077 CTATGCAAACACATGTAGTCAGG + Intergenic
991282248 5:64928183-64928205 CTGAGGAAACACAGTGAATGTGG - Intronic
992054063 5:72969945-72969967 CTATGGAAAAACCTTTACTGAGG - Intronic
992818964 5:80475112-80475134 GTATGTAAACAAATTAAGTGTGG + Intronic
993194000 5:84717258-84717280 ATATGGAAACACGGTGAATGTGG - Intergenic
993279231 5:85904412-85904434 CGATGAAATCACAATGAGTGTGG - Intergenic
997959485 5:138308572-138308594 CTATAGAAAAACAGTGAGTTGGG - Intronic
998620275 5:143786937-143786959 GCATGGACACACATGGAGTGAGG + Intergenic
999073986 5:148777626-148777648 CTATTGAAGCCCATTGACTGGGG + Intergenic
1003518225 6:6835286-6835308 CTATAGATACAGATAGAGTGGGG - Intergenic
1004257150 6:14075127-14075149 TCATGGTAACACTTTGAGTGAGG + Intergenic
1007727029 6:43922800-43922822 CTAAGGACACACTATGAGTGAGG + Intergenic
1011260810 6:85468044-85468066 ATATGGAAACACATTTAATTTGG - Intronic
1011982214 6:93393840-93393862 TTATGGAAACTCTTTGAATGAGG + Intronic
1012391043 6:98740493-98740515 CTATGGAGAAGCATTGACTGTGG + Intergenic
1013029305 6:106316082-106316104 CTATGTAAGTACATTGATTGTGG - Exonic
1013315660 6:108940277-108940299 ACATGGACACACATGGAGTGAGG + Intronic
1014817101 6:125948047-125948069 CTGTGGAAAAACATTAATTGTGG - Intergenic
1016131874 6:140483571-140483593 CTACAGAAAAACTTTGAGTGTGG - Intergenic
1017181161 6:151553677-151553699 CTTTGGAAACACATTCACTTTGG + Intronic
1018632382 6:165832462-165832484 TTTTGGAAGCACATTGAGTGGGG + Intronic
1019593275 7:1846360-1846382 CTATGGAAACACTGTCCGTGAGG - Intronic
1020269028 7:6581219-6581241 CTATGGGAAGGCATTGAGTTGGG + Intronic
1020787012 7:12586086-12586108 TTTTAGAAACACAGTGAGTGAGG - Intronic
1022081118 7:27022488-27022510 ACATGGATACACAATGAGTGAGG + Intergenic
1022530480 7:31063833-31063855 CTATGGCCACACAGTGAGTCAGG - Intronic
1023542118 7:41276689-41276711 CTGTGGGTACACAATGAGTGTGG + Intergenic
1026230415 7:68478371-68478393 CTATATAACCTCATTGAGTGAGG - Intergenic
1026913705 7:74107262-74107284 CTATGGAAACACAGTGGAAGGGG + Intronic
1032033751 7:128506115-128506137 CTCTGAAAACCCATTAAGTGGGG - Intronic
1034708942 7:153173514-153173536 CTTGGGAAAGACATTGAGAGAGG - Intergenic
1035983965 8:4404804-4404826 CTATGGGTACACAGTAAGTGAGG + Intronic
1036515148 8:9436956-9436978 CTATGGAAAAACACTGAGAGAGG + Intergenic
1036910080 8:12751145-12751167 CTATGGATAGACATGCAGTGTGG - Intronic
1037449307 8:19000868-19000890 CTAAAGAAACATATTGAATGAGG + Intronic
1037865105 8:22437186-22437208 CTATAGGAACACATTAAATGAGG - Intergenic
1038829671 8:31043148-31043170 CTATGAAAACACCTTCAGGGTGG + Intronic
1039540004 8:38358424-38358446 CTATGGAAACACATTGAGTGTGG - Intronic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1041182207 8:55260503-55260525 ACATGGACACACATGGAGTGAGG + Intronic
1042795008 8:72652425-72652447 CCATGGAAAAACATTGGCTGTGG - Intronic
1045692622 8:104775108-104775130 CTATGGAAAGACAGTGAGTGGGG + Intronic
1047724006 8:127668946-127668968 CTCTTGCAACACATTGTGTGAGG - Intergenic
1051202982 9:14650054-14650076 CTATGGAAACATGTTTAATGAGG + Intronic
1053502266 9:38608786-38608808 TTATGGAAACACATTACTTGAGG + Intergenic
1055727125 9:79242552-79242574 CTCTGTAAACGCATTGAGTATGG + Intergenic
1057153773 9:92820541-92820563 CTGTGGAAACACATTACTTGAGG - Intergenic
1057681663 9:97193206-97193228 TTATGGAAACACATTACTTGAGG + Intergenic
1059387572 9:113976684-113976706 CTATGAAAACAAAAGGAGTGGGG - Intronic
1059907603 9:119005550-119005572 CTTTGGAGACACATTGAGCTGGG + Intergenic
1060013053 9:120061483-120061505 CTATGGCAACCCATGGATTGAGG - Intergenic
1062366434 9:136211652-136211674 CTCTGGAGACACAATGACTGTGG + Intronic
1186483854 X:9917895-9917917 CTATAGAAACAGATTGTGTTAGG - Intronic
1186863632 X:13697128-13697150 CTATACAAACTCACTGAGTGAGG - Intronic
1187245683 X:17551117-17551139 CTATGGAGAAAAATTAAGTGAGG - Intronic
1187533569 X:20117379-20117401 CTGTGTTCACACATTGAGTGAGG - Intergenic
1187842661 X:23504988-23505010 CTAAGGGAAAACACTGAGTGAGG + Intergenic
1188244731 X:27825611-27825633 ATTTGAAAACACTTTGAGTGTGG - Intergenic
1190411776 X:50143700-50143722 CTATAAAAACACATTGAGTTTGG + Intergenic
1190827660 X:54032389-54032411 CTATTGGAACAGAGTGAGTGAGG - Intronic
1190833830 X:54082232-54082254 TGATGGAAGCACATTTAGTGAGG + Intronic
1196189514 X:112780136-112780158 CTGTTGACACAGATTGAGTGTGG + Intronic
1200342396 X:155411164-155411186 CTATGGAAACACATCCATTCAGG - Intergenic
1201643376 Y:16201761-16201783 CTATGGAAACAGATATACTGTGG + Intergenic
1201659439 Y:16383560-16383582 CTATGGAAACAGATATACTGTGG - Intergenic
1201684895 Y:16690204-16690226 CTGTGGACACACAAGGAGTGAGG - Intergenic
1201908517 Y:19109115-19109137 CAATGGGAACACATGGACTGAGG - Intergenic