ID: 1039545114

View in Genome Browser
Species Human (GRCh38)
Location 8:38404378-38404400
Sequence TCCTGCCACTGGAGAACGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039545114_1039545118 -9 Left 1039545114 8:38404378-38404400 CCTCCCGTTCTCCAGTGGCAGGA 0: 1
1: 0
2: 1
3: 13
4: 131
Right 1039545118 8:38404392-38404414 GTGGCAGGACCTCCACCTGAAGG 0: 1
1: 0
2: 2
3: 7
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039545114 Original CRISPR TCCTGCCACTGGAGAACGGG AGG (reversed) Exonic
900434719 1:2623984-2624006 TCCTGCCTCTAGAGGAGGGGTGG + Intronic
901097895 1:6697255-6697277 TCTTGTCATAGGAGAACGGGGGG + Intronic
901901830 1:12371214-12371236 TCCTGCGGCTGGAGACAGGGAGG - Intronic
902318030 1:15638481-15638503 ACCTGACACGGGAGAAGGGGAGG + Intronic
903139343 1:21329692-21329714 ACCTGCCACAGGAGAACTGAGGG + Intronic
905104725 1:35557581-35557603 GACTGCCTCTGGAGAGCGGGCGG - Intronic
907526464 1:55056775-55056797 TCCTGACACTGGAGGAGTGGTGG - Intronic
911274136 1:95840448-95840470 CCCTGCCACTGGAGATGGTGAGG + Intergenic
911333952 1:96558705-96558727 TCCTGCCATTGGAGACTGAGTGG - Intergenic
911431298 1:97791108-97791130 TCATGCCACTTGAGAACTGTGGG - Intronic
913535397 1:119767354-119767376 TTCTGCCAGTGAAGAACTGGAGG + Intronic
913578103 1:120197335-120197357 TCCTGCCTCTGGAGCCCGGGAGG + Intergenic
913630067 1:120701017-120701039 TCCTGCCTCTGGAGCCCGGGAGG - Intergenic
914560021 1:148808755-148808777 TCCTGCCTCTGGAGCCCGGGAGG + Intronic
914612812 1:149321460-149321482 TCCTGCCTCTGGAGCCCGGGAGG - Intergenic
915016607 1:152740007-152740029 TCCTGACACTGGAGCAATGGAGG - Intronic
916022713 1:160808009-160808031 CCCTGCCACTGGAGAAGGTGAGG + Intronic
919033602 1:192277485-192277507 TCTTGCTACTGGAAAACAGGAGG - Intergenic
1062997595 10:1881628-1881650 TCCTGCCTGTGGAAAACCGGAGG - Intergenic
1065467818 10:26044272-26044294 GCCTGTCATTGGAGAAGGGGTGG + Intronic
1066390656 10:34975293-34975315 TCCTGTCTCTGAAGAACAGGAGG + Intergenic
1068569783 10:58616263-58616285 TCCCCCCACTGGAGAACAGGGGG + Intronic
1071450740 10:85789919-85789941 TGCTGCCACTGCAGAACTTGGGG - Intronic
1073073801 10:100810793-100810815 TCCTGCCACAGGAGACCCAGGGG + Intronic
1078430589 11:11285188-11285210 TCCTGCCTCTGGAAAACCAGTGG - Intronic
1078450783 11:11439105-11439127 TCCAGCCACTGGACAATGGAGGG + Intronic
1079346910 11:19660643-19660665 TCCTGCCAGTCGAGAAAGTGTGG + Intronic
1080056548 11:27912601-27912623 TCCAGCCTCTGGAGAAGGTGTGG + Intergenic
1081680237 11:44997488-44997510 TCCTCCTAGTGGACAACGGGTGG + Intergenic
1083206008 11:61149815-61149837 CCCTGCCTCTGGACAAAGGGGGG - Intronic
1084291314 11:68170494-68170516 TCCTGCCAATGAAGATCTGGGGG + Intronic
1084424053 11:69074928-69074950 TCCTGACACTGGAAAAGGGTGGG - Intronic
1084856517 11:71991687-71991709 TCCTGTCACGGGAGAAAGTGTGG + Intronic
1084998922 11:73011307-73011329 CCCTGCCACTGGAAAAGGGAGGG + Intronic
1089521245 11:119065592-119065614 TTCTGCCATTGGACAACAGGGGG + Intergenic
1090722565 11:129489903-129489925 TCCTGCTTCTGGGGATCGGGTGG - Intergenic
1096080750 12:48830779-48830801 TCCTGCCTTTGGAGATGGGGTGG - Intronic
1099785951 12:87264177-87264199 TCCTGCCACTGAAGCATTGGTGG - Intergenic
1100054736 12:90495168-90495190 TCCTGCCACAGCAGAAAGGATGG - Intergenic
1100191788 12:92200676-92200698 TCCTGCCACTGGGCATCTGGAGG + Intergenic
1101138823 12:101773717-101773739 TTCTGCCACTGTAAAAAGGGTGG + Intronic
1102549227 12:113679056-113679078 TTCTTCCACTGGAGAGCGGCTGG - Intergenic
1103327411 12:120130789-120130811 TCCTGGCTCTGGGGAAGGGGTGG - Intronic
1104474894 12:129063221-129063243 TCCTGCCCCTTAAGGACGGGGGG + Intergenic
1104927075 12:132319367-132319389 TCCTGCCTGTGGACATCGGGTGG + Intronic
1107825751 13:44327427-44327449 TCCTGCAGCAGGAGAAAGGGGGG + Intergenic
1108409750 13:50133906-50133928 CCCTGCCACTGGACCATGGGCGG - Intronic
1118502950 14:66380356-66380378 CTCTGCCACTGGAGAGCAGGTGG + Intergenic
1119473832 14:74915685-74915707 TGCTGCCACAGGGGAATGGGAGG + Intronic
1119548819 14:75493285-75493307 TCGCGCCCCTGGAGAAAGGGAGG + Intergenic
1119982804 14:79101356-79101378 TCCTGCCACTCCAGAAGGTGGGG - Intronic
1124500222 15:30221817-30221839 ACCTGCCACTGGAGCAGGGTGGG - Intergenic
1124743353 15:32316849-32316871 ACCTGCCACTGGAGCAGGGTGGG + Intergenic
1125675627 15:41501171-41501193 CTCTGCCACTGAAGAACGCGTGG - Intronic
1127846682 15:62876796-62876818 TCCTACCACTGCAGAATTGGGGG - Intergenic
1128078871 15:64844458-64844480 TGCTGCCATTGGAGTAAGGGTGG + Intronic
1128904289 15:71453218-71453240 TCTTGCCACAGGGGAAAGGGTGG - Intronic
1129088194 15:73119613-73119635 TGCTGCCTCTGGAGAACTGCAGG - Intronic
1129696503 15:77743287-77743309 CCCTGCCCCTGGAGAACGCTGGG - Intronic
1134397184 16:13875846-13875868 TACTGCCACTGGAGCACGAAAGG - Intergenic
1135294171 16:21264856-21264878 TCCTTACACTGGAGGATGGGGGG - Intronic
1138014168 16:53413883-53413905 CCCAGCCACTGGAGAAGGTGAGG - Intergenic
1138593064 16:58013169-58013191 GCCTGCCTCTGGAGTAGGGGTGG + Intronic
1140420730 16:74816890-74816912 TCCTGCCACAGGCGAAGGGGTGG + Intergenic
1141733112 16:85835372-85835394 TCCTGCCACTGGTGGACGTGGGG - Intergenic
1144079265 17:11747741-11747763 TCCAGCCACAGGAGAATGGAAGG + Exonic
1152948383 17:83211104-83211126 GCCTGCCGCTGGAGAGCGTGGGG - Intergenic
1155075280 18:22348877-22348899 TCCTGGCGCTGGAGAAGCGGTGG + Intergenic
1161224273 19:3136020-3136042 TCCTCCTTCTGGAGAAGGGGCGG - Intergenic
1164572853 19:29386617-29386639 TCCTCCCACTTGAGAACTTGAGG + Intergenic
1166742499 19:45122850-45122872 TCCTGCTTATGGAGCACGGGAGG - Intronic
1168078475 19:53992897-53992919 TCCTGCAAGAGGAGAACCGGCGG + Exonic
927810177 2:26176096-26176118 TCCAGCCACTGATGAACGAGGGG + Intronic
927965263 2:27264075-27264097 TGCCGCCACTGTAGAATGGGAGG + Intronic
930539019 2:52681118-52681140 TCCTGCTACTGGAAAAAGTGGGG - Intergenic
931521857 2:63106421-63106443 GCCTGCCACTGGGGAAAGTGGGG + Intergenic
931747253 2:65301063-65301085 TCCTGCCACTGCAGACTTGGCGG - Intergenic
936114473 2:109691092-109691114 TCCTGGCACTGCAGAACTTGAGG + Intergenic
937671992 2:124547784-124547806 TCCTGCCACGGGAGGAAGTGGGG + Intronic
938796899 2:134725076-134725098 CCCTGCCACTGGAGAGGGTGGGG - Intergenic
940711721 2:157170079-157170101 TTCTGCCTCTGGAGAGCTGGAGG - Intergenic
941071443 2:160959337-160959359 TCCTTCTACTGGAGACAGGGAGG - Intergenic
941870676 2:170381840-170381862 TCCTGCCACTGTAGAACTATTGG - Intronic
947834532 2:233166097-233166119 TCCTGCCACAGTAGAAGGGTGGG + Intronic
949070397 2:242020966-242020988 TCCTGCAGCTGGAGACCCGGGGG + Intergenic
1170523685 20:17215309-17215331 TCCTGCCTCTGCAGACCAGGTGG - Intergenic
1175525231 20:59629225-59629247 CCCTGCCACTGGAGCATGGTGGG - Intronic
1178668786 21:34572289-34572311 GCCTGCCACTGGAGAAGCAGTGG - Intronic
1179583593 21:42360813-42360835 TTCTGACACTGGAGAACTGTGGG + Intergenic
1182464498 22:30505898-30505920 TCCTGCCACCTGCGAACAGGCGG - Intergenic
1183075965 22:35426898-35426920 ACCTGGAACTGGAGAAGGGGTGG - Intergenic
1184743597 22:46443346-46443368 CCCTGCCAGTGCAGAACAGGCGG - Intronic
952744534 3:36764545-36764567 TCCTGGCCCTGGAGGCCGGGCGG + Intergenic
961520286 3:127463647-127463669 TCCTACCACTGCAGAATGGATGG - Intergenic
961943548 3:130661815-130661837 TTCTGTCACTGGAGACCGGGTGG + Exonic
962598996 3:136976359-136976381 TCCTCCCACTGGAGAAGGTGGGG + Intronic
964385103 3:156138908-156138930 TCCTGCTGATGGAGCACGGGAGG - Intronic
968434926 4:579491-579513 CCCTGCCACTGGGGAGCTGGTGG + Intergenic
968495204 4:911387-911409 TGCTGCCACTGGAGACAGGCAGG + Intronic
968540252 4:1164690-1164712 TGCTGCCACAGGTGGACGGGGGG - Intergenic
970848121 4:20567503-20567525 TCCTGCCCCTGGAGAAGAAGGGG - Exonic
972803015 4:42497108-42497130 TGCTGCCACTGGAGAAGGTACGG + Intronic
972909433 4:43796846-43796868 TGCTGCCACTGCAGAAGGGTGGG - Intergenic
976772929 4:88674079-88674101 TCTTTCTACTGGAGAAGGGGAGG - Intronic
984400792 4:179261558-179261580 TCCTACCACTGGAGGTGGGGAGG - Intergenic
985890612 5:2712559-2712581 TCCTGCCACTGGGGGTGGGGGGG - Intergenic
985929814 5:3048192-3048214 TCCTGCCACTGTTGAAAGGATGG + Intergenic
990483543 5:56235404-56235426 TGCTACCACTGGAGATGGGGAGG - Intergenic
992771364 5:80051176-80051198 TGCTGCCTCTGGAGAAGGTGAGG + Intronic
998599541 5:143571045-143571067 TGCTACCACTGGAGAAAGTGAGG - Intergenic
999856670 5:155602215-155602237 TTGTGCCACTGGAGAAAGTGTGG - Intergenic
1000454982 5:161437805-161437827 TCCTGCCATTGGATAAGGGGAGG + Intronic
1001836663 5:174838190-174838212 TCATGCCACTGGAGAATGCTGGG + Intergenic
1002287842 5:178177092-178177114 TCCAGCCACTGTAGAATGTGGGG + Intergenic
1003474059 6:6465194-6465216 ACCTGCCACTGGAGAACAGGGGG + Intergenic
1010608542 6:77922943-77922965 TCCTGTCACTGGTGAACAAGGGG - Intronic
1010609743 6:77939833-77939855 TGCCGCCTCTGAAGAACGGGAGG + Intergenic
1016259063 6:142146074-142146096 TCCTACCACTGGAGAATGTATGG - Intergenic
1018756997 6:166858571-166858593 TCTTGCCAGTGGAGAAAGCGTGG + Intronic
1022783434 7:33610448-33610470 TCCTGCCTCTGGAGAATGCAAGG - Intergenic
1026245956 7:68619882-68619904 TCCTGCCAGTGGAGATGGGGTGG - Intergenic
1029635892 7:101783502-101783524 TCCTCCTGCTGGAGAAGGGGTGG + Intergenic
1030306777 7:108026834-108026856 TGCTGCCACTTGAGAAGGGGCGG - Intronic
1030339418 7:108359870-108359892 GGTTGCCACTGGAGAATGGGAGG - Intronic
1033283531 7:140022224-140022246 TCCTGCCGGTGCAGAAAGGGTGG - Intergenic
1037819075 8:22127115-22127137 TCCAGGCACTGCAGAACAGGGGG - Exonic
1037890905 8:22623298-22623320 TCCTTCCACTCGGGGACGGGAGG - Intronic
1038038689 8:23706530-23706552 TCCTGCGACTGGAGCGCGAGCGG - Exonic
1039545114 8:38404378-38404400 TCCTGCCACTGGAGAACGGGAGG - Exonic
1040476402 8:47782098-47782120 ACCTGCCACTGGAGAAGTGAGGG + Intronic
1043398012 8:79857375-79857397 CTCTGCCACTGGAAAACTGGTGG + Intergenic
1046777892 8:118183198-118183220 TCCTCCCACAGGAAAAGGGGAGG - Intergenic
1049283714 8:141763338-141763360 TCCTACCACTGGGGAAGGAGGGG + Intergenic
1049822000 8:144641154-144641176 TTCTGCCACAGGATCACGGGGGG + Intergenic
1053023011 9:34708782-34708804 TCCTGCCAATGGAGAGGTGGTGG - Intergenic
1060801114 9:126546366-126546388 TCCTGCCCCTGCTGAACGTGGGG + Intergenic
1061918091 9:133767689-133767711 TCCGGCCACTGGACAATGGAAGG + Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062262834 9:135671436-135671458 TCCTGGCACTGCAGAGCGGATGG + Intergenic
1062451950 9:136619475-136619497 TCCTGCCACGGGAGGAAGAGGGG + Intergenic
1203608456 Un_KI270748v1:75478-75500 GCCTGCCGCTGGAGAGCGTGGGG - Intergenic
1185761125 X:2690813-2690835 TGCTCCCACTGGAGACCAGGGGG + Intergenic
1188470305 X:30530492-30530514 TCCAGCCACTGAAGAACAAGAGG - Intergenic
1190974905 X:55389553-55389575 CCCTGCCACTGGACAAGGTGGGG - Intergenic
1193450415 X:81658323-81658345 CCCTGCCAATGGAGAAGGTGGGG + Intergenic
1195615552 X:106909358-106909380 TCCTGCCACTGGGGAGCAGTGGG + Intronic