ID: 1039545114

View in Genome Browser
Species Human (GRCh38)
Location 8:38404378-38404400
Sequence TCCTGCCACTGGAGAACGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039545114_1039545118 -9 Left 1039545114 8:38404378-38404400 CCTCCCGTTCTCCAGTGGCAGGA 0: 1
1: 0
2: 1
3: 13
4: 131
Right 1039545118 8:38404392-38404414 GTGGCAGGACCTCCACCTGAAGG 0: 1
1: 0
2: 2
3: 7
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039545114 Original CRISPR TCCTGCCACTGGAGAACGGG AGG (reversed) Exonic