ID: 1039553359

View in Genome Browser
Species Human (GRCh38)
Location 8:38459192-38459214
Sequence CATTTAGGACAGAAGCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039553359_1039553366 21 Left 1039553359 8:38459192-38459214 CCAGGTGGCTTCTGTCCTAAATG 0: 1
1: 0
2: 0
3: 11
4: 143
Right 1039553366 8:38459236-38459258 ATTCAGAGAATCTACTTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039553359 Original CRISPR CATTTAGGACAGAAGCCACC TGG (reversed) Intronic
902746655 1:18479101-18479123 CATTTGGGACAATAGCCAGCAGG - Intergenic
905243502 1:36596595-36596617 CAGTCAGGACAGAAGGCACCAGG - Intergenic
905299237 1:36974963-36974985 CAAGTAGGACAGAAGTTACCAGG + Intronic
905807541 1:40887738-40887760 CATTCAGTAGAGAAGCCAACCGG - Intergenic
906573864 1:46869842-46869864 CATTCAGGACATAGGACACCGGG + Intergenic
911043847 1:93612708-93612730 TATTTAGGCCAGAAACCACATGG + Intronic
914687511 1:149994033-149994055 CAATTAGTACACAAGCCATCTGG + Intronic
914998849 1:152569025-152569047 CATGGAGGACAGAAGCCAGTTGG - Intronic
917198513 1:172491867-172491889 GAAATAGGACAGATGCCACCTGG + Intergenic
920503078 1:206497625-206497647 CACAGAGGACAGAAGCCTCCAGG - Exonic
1063942608 10:11145829-11145851 CATTTTAAACAGAAGCTACCTGG - Intronic
1066349510 10:34624586-34624608 CACTGAGCCCAGAAGCCACCAGG + Intronic
1069011797 10:63382258-63382280 CAATTATGACAGAAACCATCTGG - Intronic
1073419595 10:103413623-103413645 CAATTAGGACAGAGACCACAGGG - Intronic
1073808437 10:107125723-107125745 CAATTAAGACACAAACCACCAGG - Intronic
1073838423 10:107470738-107470760 CATGTAGGACAGGAGCCATATGG + Intergenic
1074976565 10:118586660-118586682 CACTTAGTACAGAAGTCAACTGG + Intergenic
1075394573 10:122117726-122117748 CATTTAGAATAGAAGGCTCCTGG + Intronic
1076031737 10:127164883-127164905 CATTTGGCCCAGAAGGCACCAGG + Intronic
1076301992 10:129435444-129435466 CATTTAGTACTGAAGACACTGGG + Intergenic
1076717305 10:132372818-132372840 CAACCAAGACAGAAGCCACCTGG + Intronic
1080393047 11:31865754-31865776 CATTGAGGACAGGAGCCAGCAGG + Intronic
1080394200 11:31875013-31875035 CAATTATGAGAGAACCCACCGGG + Intronic
1080971499 11:37282551-37282573 CAGTTATGACAGTAGCCATCTGG + Intergenic
1081725120 11:45322582-45322604 AAACTAGGACAGTAGCCACCAGG - Intergenic
1082099903 11:48164026-48164048 AATTTAGGACAGAAGACAGGAGG + Intronic
1084607725 11:70182246-70182268 CTTCTAGGAGAGAAGGCACCAGG - Intronic
1084782002 11:71416105-71416127 CATTTATAACAGCAGCCACACGG + Intergenic
1084795185 11:71500742-71500764 GATATAGGGCAGCAGCCACCTGG - Intronic
1084968616 11:72757396-72757418 CACTTGTGACAGAAGCCACAGGG + Intronic
1085840634 11:80007952-80007974 CATTTATGAAAGAAGAAACCAGG - Intergenic
1089346738 11:117796114-117796136 CATTTCCGACTGAAGCCACCTGG - Intronic
1091930478 12:4391868-4391890 TCTTCAGGACTGAAGCCACCAGG + Intergenic
1098963447 12:76762850-76762872 CTGTTAGGCCAGAAACCACCAGG - Intergenic
1099351251 12:81571627-81571649 CACTTAGGACAGAACACACAGGG + Intronic
1101562870 12:105875840-105875862 CATTAAGAACAGAAGCAACAAGG + Intergenic
1102023483 12:109699794-109699816 CAATTAGGCCAGAAGCCATCAGG - Intergenic
1102421915 12:112809947-112809969 CATATAGAACTGAAGCCAGCAGG - Intronic
1104809927 12:131613941-131613963 CAGCTGGGACAGAACCCACCGGG - Intergenic
1105991641 13:25627847-25627869 CATTTATGACAGAATCCAACAGG - Intronic
1107651799 13:42552494-42552516 CATTTAGGACAAAAGAGTCCAGG + Intergenic
1108575153 13:51784177-51784199 CCTTGAGGGCAGAATCCACCTGG - Intronic
1111105880 13:83644094-83644116 AATTCAGCAGAGAAGCCACCAGG + Intergenic
1111223510 13:85238537-85238559 TATTTAGGACAGATGCCATTGGG + Intergenic
1111554364 13:89860998-89861020 CACTTAGGAGAAAAGGCACCTGG + Intergenic
1112703917 13:102044263-102044285 CAGTTAGGACAGCATCTACCAGG - Intronic
1112831183 13:103453606-103453628 CATTTGGAACAGAAGGCATCAGG + Intergenic
1114201594 14:20525963-20525985 CATTTAGTCCTAAAGCCACCAGG - Intergenic
1114318760 14:21529344-21529366 GATTTAGAAGGGAAGCCACCTGG - Intronic
1116178672 14:41508003-41508025 CATTTATGACAGAATCTACTAGG - Intergenic
1118005782 14:61563257-61563279 CCTTTAGGACAGGTGCCCCCAGG + Intronic
1118850708 14:69581055-69581077 AATTTAGGACACAAACCAGCAGG + Intergenic
1120823737 14:88936267-88936289 GATTTATGACAGAAGCCCCAGGG + Intergenic
1123037203 14:105476322-105476344 CAGGCAGGACAGAAGCCAGCCGG - Intronic
1125194555 15:37031298-37031320 CATTTAAGAAAGAAGCCATCTGG + Intronic
1127665478 15:61141947-61141969 CACTTAGCCCAGGAGCCACCTGG - Intronic
1128107603 15:65056035-65056057 CTTTCAGGTCAGAAGCCTCCAGG - Intronic
1128647280 15:69387009-69387031 CAGGTAGGAGAGAAGTCACCTGG - Intronic
1129172950 15:73818923-73818945 AATTTAAGACAGAGGCCACTGGG - Intergenic
1129614919 15:77090823-77090845 CATTTTGGAGAGAATCCACATGG + Intergenic
1130717583 15:86350857-86350879 CCATTAGGGCATAAGCCACCAGG - Intronic
1132170895 15:99653118-99653140 CATTTAGGGCAGAAGATACTAGG + Intronic
1133047992 16:3099805-3099827 AAGTTGGGACAAAAGCCACCTGG - Intergenic
1133168587 16:3965975-3965997 CATACTGGACAGAAGGCACCAGG + Exonic
1140875576 16:79149719-79149741 CATTTAGGACCGCAGCCAGTGGG + Intronic
1143354844 17:6319190-6319212 CAGTTAGAACAGAAACCACATGG + Intergenic
1146476005 17:33163288-33163310 CCTCTAGGACAGAAGCTAACAGG - Intronic
1153502787 18:5766401-5766423 GATTTCAGGCAGAAGCCACCAGG - Intergenic
1157285557 18:46374950-46374972 CATTTAGGAGGGAAGCCAGGAGG - Intronic
1158324100 18:56295522-56295544 CATTTAGGAGAGAAAGCAGCTGG - Intergenic
1158931174 18:62325833-62325855 AATTTGGGACGGAGGCCACCCGG - Intronic
1161187891 19:2934805-2934827 CATTTTGAACAGAAGTCAGCTGG - Exonic
1161577749 19:5064220-5064242 CAGGTTGGACAGAGGCCACCTGG - Intronic
1161686374 19:5704631-5704653 CAGCCAGGACAGAACCCACCTGG - Intronic
1164881408 19:31735487-31735509 CATGTTGGACTTAAGCCACCAGG + Intergenic
1166259517 19:41627759-41627781 CACAGAGGACAGAGGCCACCCGG - Intronic
930398946 2:50858810-50858832 TATCTAGAACAGAACCCACCTGG + Intronic
931884345 2:66599545-66599567 CATTGACGATAGAAACCACCTGG + Intergenic
932786222 2:74606240-74606262 ATTTTAAGACAGAAGCCACAGGG + Intronic
933944700 2:87275935-87275957 TATTTTGGGCAGAAGCTACCCGG + Intergenic
934119701 2:88827641-88827663 CATTAAGAACTGAAGCCAACTGG + Intergenic
935054440 2:99553261-99553283 CATGGGGGTCAGAAGCCACCAGG - Intronic
936163167 2:110100180-110100202 CATTAAGAACTGAAGCCAACAGG + Intronic
936335510 2:111585643-111585665 TATTTTGGGCAGAAGCTACCCGG - Intergenic
941159515 2:162020267-162020289 CATTTATTACAAAAGGCACCTGG - Exonic
942737290 2:179128939-179128961 CATTTAGGACACAAGCAGTCAGG + Intronic
944955652 2:204805453-204805475 AATTCAGTACAGAAGCCACCAGG - Intronic
1174916791 20:54662026-54662048 GGTTGAGGACAGAAGCCACAGGG + Intergenic
1176186438 20:63782531-63782553 CATTTATTACAGCAGCCATCAGG + Intronic
1179998689 21:44985443-44985465 CATTTTAAACACAAGCCACCAGG - Intergenic
1181424400 22:22823658-22823680 CAATCTGGACAGAAGCCATCAGG + Intronic
1181790107 22:25258657-25258679 CATGTAATACAAAAGCCACCGGG + Intergenic
1184410236 22:44322080-44322102 CAGAAAGAACAGAAGCCACCAGG + Intergenic
1185168280 22:49275769-49275791 CATTCAGGCCTGAATCCACCTGG + Intergenic
951162662 3:19444355-19444377 AATTTAGGTCAAAATCCACCTGG - Intronic
954697247 3:52434472-52434494 CAGTTAGCTCAGAAGCCACCTGG - Exonic
955330224 3:58041297-58041319 CATTTATGAGAGAAGCAGCCAGG + Intronic
955878556 3:63520287-63520309 CAATCAGGACTGAAGCCAACTGG - Intronic
955934178 3:64086972-64086994 CATTCAGGGCAGAAGCAACACGG + Intergenic
958501612 3:94917686-94917708 TATTTATGACTGAAGCCTCCAGG + Intergenic
958644829 3:96856262-96856284 AGTTTATGACAGAAGCAACCTGG + Intronic
958933123 3:100228974-100228996 GTTTAAGGAAAGAAGCCACCAGG + Intergenic
959412096 3:106036923-106036945 CCTTGAGGATAGAAGCCACATGG + Intergenic
960486042 3:118254164-118254186 CATTTATGGCAGAAGCCCCCTGG + Intergenic
962439984 3:135404669-135404691 CATTAAGGACAGGAGCAACAGGG + Intergenic
962511468 3:136105266-136105288 CACTTTGCACAGCAGCCACCTGG - Intronic
962927015 3:140004335-140004357 CATTTATGACAGGTGCCATCTGG + Intronic
974013706 4:56629954-56629976 CAATTATGACAGAAGGCAACGGG - Intergenic
974307924 4:60165338-60165360 TAGTTAGAACAGAAGCCACTAGG + Intergenic
975688170 4:76938637-76938659 TAATTAGGATAAAAGCCACCTGG - Intergenic
984471921 4:180187273-180187295 CACATAGGACAAAAGCTACCTGG - Intergenic
985392866 4:189509689-189509711 CATGAAGGACAGAAGACAACAGG - Intergenic
987925580 5:24336695-24336717 CATTTAGGAGAGATGGCACAGGG - Intergenic
988737228 5:34034772-34034794 CATCAAGGACAGCAGCCAGCAGG - Intronic
993877717 5:93327634-93327656 CATGCAGGACAGAAGCAGCCTGG + Intergenic
999187299 5:149721272-149721294 CATTTGTGAGAGAAGTCACCTGG - Intergenic
1001179296 5:169503765-169503787 TATTTAGGACACAAAACACCAGG - Intergenic
1002710959 5:181194860-181194882 CAGTCAGGGCAGAAGCCCCCTGG + Exonic
1004600968 6:17149728-17149750 CAATTAGGACACAATCTACCTGG + Intergenic
1006772300 6:36563816-36563838 CATTTTGGAGAGAAGGCAGCTGG - Intergenic
1008158584 6:48048714-48048736 CATTTAGGAGAGAACACAGCTGG - Intronic
1010034784 6:71312164-71312186 CATTTAGGAAACAAACCACTGGG + Intergenic
1011212161 6:84966775-84966797 CCTTGATGACAAAAGCCACCTGG + Intergenic
1012332263 6:98007537-98007559 CTTCTAAGACAGAAACCACCAGG - Intergenic
1012666571 6:101978130-101978152 CATGAAGATCAGAAGCCACCTGG - Intronic
1012932505 6:105331664-105331686 CAGTTTGGACAGAAGCCATCAGG + Intronic
1014539677 6:122660137-122660159 CATGTATGTCAGAATCCACCAGG - Intronic
1015392400 6:132697252-132697274 CTTTGAAGACAGAAGCAACCTGG + Intronic
1019533737 7:1516861-1516883 CCTGCAGGACAGAAGCCCCCGGG - Intergenic
1025954306 7:66170750-66170772 CATTTAACCCAGAACCCACCAGG - Intergenic
1027524467 7:79249685-79249707 CATTTAGGAGTGAAGCCATCAGG - Intronic
1028942835 7:96543868-96543890 CATTTAGCTAAGAAGCTACCAGG + Intronic
1032395427 7:131586140-131586162 CAGGGAGGACAGAAGCCATCAGG + Intergenic
1034285285 7:149879912-149879934 CATCTAGGACTGAGGCCATCTGG - Exonic
1034692314 7:153023619-153023641 CATTTCTGAGAGAAGCCCCCAGG + Intergenic
1035308150 7:157946637-157946659 CAGTTAGGCCAGCAGCCACAGGG + Intronic
1039553359 8:38459192-38459214 CATTTAGGACAGAAGCCACCTGG - Intronic
1040399151 8:47030715-47030737 CATTTATGACAGGAGTCAGCTGG + Intergenic
1043592447 8:81846634-81846656 TATTTTGGTCAGAAGCCTCCTGG - Intergenic
1044854525 8:96461259-96461281 CATTTTGGGCAGAAATCACCAGG + Intergenic
1045148370 8:99373497-99373519 CATTTGTCACAGAATCCACCAGG - Intronic
1048883904 8:138893083-138893105 CTCTTAAGACAGGAGCCACCTGG - Intronic
1050128593 9:2385890-2385912 CGTTTTGGACAGGAGGCACCAGG - Intergenic
1050866400 9:10505792-10505814 CATCTAGCATAGAAGCCAACAGG + Intronic
1050881980 9:10712934-10712956 GATTTCGGACATGAGCCACCAGG - Intergenic
1050980147 9:12000331-12000353 AATTCAGCACTGAAGCCACCAGG - Intergenic
1052932871 9:34070050-34070072 AACTTTGGACAGAATCCACCTGG - Intergenic
1053057543 9:35002848-35002870 AAGTCAGGACAGTAGCCACCAGG + Intergenic
1056488011 9:87078234-87078256 CAATTAGGACACCAGCCATCAGG + Intergenic
1059977312 9:119731300-119731322 CATTTGGGACAGAAGTAAGCTGG - Intergenic
1185700247 X:2226154-2226176 CAGTCAGGAGAGAAGTCACCTGG - Intronic
1193466665 X:81855895-81855917 AATTTAGCAATGAAGCCACCAGG - Intergenic
1193561732 X:83026176-83026198 CATTCAGCACAGAAGTCATCAGG - Intergenic
1194521465 X:94923273-94923295 AATTCAGCACAGAAGCCATCGGG - Intergenic
1197682424 X:129400657-129400679 GATTTAGGACATAAGCAACTGGG + Intergenic