ID: 1039554214

View in Genome Browser
Species Human (GRCh38)
Location 8:38465562-38465584
Sequence TATCCTACCCCCAGTGGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 74}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039554214_1039554221 10 Left 1039554214 8:38465562-38465584 CCTAACCCACTGGGGGTAGGATA 0: 1
1: 0
2: 2
3: 5
4: 74
Right 1039554221 8:38465595-38465617 TCATTAGGGAGGCAGGCCATCGG 0: 1
1: 0
2: 1
3: 8
4: 103
1039554214_1039554223 23 Left 1039554214 8:38465562-38465584 CCTAACCCACTGGGGGTAGGATA 0: 1
1: 0
2: 2
3: 5
4: 74
Right 1039554223 8:38465608-38465630 AGGCCATCGGCAAAGACGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 54
1039554214_1039554222 19 Left 1039554214 8:38465562-38465584 CCTAACCCACTGGGGGTAGGATA 0: 1
1: 0
2: 2
3: 5
4: 74
Right 1039554222 8:38465604-38465626 AGGCAGGCCATCGGCAAAGACGG 0: 1
1: 0
2: 2
3: 8
4: 171
1039554214_1039554218 -4 Left 1039554214 8:38465562-38465584 CCTAACCCACTGGGGGTAGGATA 0: 1
1: 0
2: 2
3: 5
4: 74
Right 1039554218 8:38465581-38465603 GATATGTAAACAAGTCATTAGGG 0: 1
1: 0
2: 2
3: 28
4: 244
1039554214_1039554220 3 Left 1039554214 8:38465562-38465584 CCTAACCCACTGGGGGTAGGATA 0: 1
1: 0
2: 2
3: 5
4: 74
Right 1039554220 8:38465588-38465610 AAACAAGTCATTAGGGAGGCAGG 0: 1
1: 0
2: 1
3: 22
4: 191
1039554214_1039554219 -1 Left 1039554214 8:38465562-38465584 CCTAACCCACTGGGGGTAGGATA 0: 1
1: 0
2: 2
3: 5
4: 74
Right 1039554219 8:38465584-38465606 ATGTAAACAAGTCATTAGGGAGG 0: 1
1: 0
2: 0
3: 17
4: 204
1039554214_1039554217 -5 Left 1039554214 8:38465562-38465584 CCTAACCCACTGGGGGTAGGATA 0: 1
1: 0
2: 2
3: 5
4: 74
Right 1039554217 8:38465580-38465602 GGATATGTAAACAAGTCATTAGG 0: 1
1: 0
2: 0
3: 9
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039554214 Original CRISPR TATCCTACCCCCAGTGGGTT AGG (reversed) Intronic
900237289 1:1598875-1598897 TAACCTAAGCCCAGTGGGGTGGG + Exonic
902078824 1:13807087-13807109 TATTCAGCCCCCAGTGGTTTTGG - Intronic
903936926 1:26902109-26902131 CATCCTTCCCCAAGTGAGTTAGG + Intronic
912760112 1:112359250-112359272 TTTCCTTCCCACAGTGGGGTAGG - Intergenic
917954053 1:180074288-180074310 TATCTTAGGCCCAGAGGGTTAGG - Intronic
922882494 1:228991197-228991219 TATACAACACCCAGTGGGTGTGG - Intergenic
1067531889 10:47080308-47080330 TCTCCTACCCACTGTGAGTTGGG - Intergenic
1067723071 10:48744175-48744197 CCTCCCACCCCAAGTGGGTTGGG - Intronic
1068796638 10:61089493-61089515 TATCCTTTCCCCTGGGGGTTGGG - Intergenic
1072285468 10:93910367-93910389 AATCCTACCCCCAATGGCCTAGG + Intronic
1074632304 10:115272241-115272263 TACCCTACACCCTGTGTGTTGGG - Intronic
1077366305 11:2162676-2162698 TCTCCTGCCCCGAGCGGGTTTGG + Intergenic
1078061106 11:8045088-8045110 TCTCCTTTCCCCAGTGGCTTAGG + Intronic
1083573248 11:63771083-63771105 TCCCCTTCCCCCAGTGGGGTTGG - Intergenic
1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG + Intronic
1088522383 11:110712900-110712922 CACCCTATCCCCAGTGGGGTGGG - Intronic
1089901414 11:121989838-121989860 CAACCTACCCCAAGTGGGTGGGG + Intergenic
1094107303 12:26828033-26828055 TATAATACCCCCAGGGGGATGGG + Intronic
1100128532 12:91460676-91460698 GATTCTACCCCCAGTGATTTAGG - Intergenic
1101976580 12:109364817-109364839 AATGCTACCTCCAGTGTGTTTGG + Intronic
1108722587 13:53147519-53147541 AATCCCACACCCAGTGTGTTCGG - Intergenic
1111189282 13:84788030-84788052 TTTCCTTCTCCCAGTTGGTTCGG + Intergenic
1111619844 13:90710417-90710439 TATCCTTCCCCCAGTGAGTTAGG - Intergenic
1118694286 14:68369238-68369260 TAGCCTAGTGCCAGTGGGTTTGG + Intronic
1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG + Intronic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1129361286 15:75026196-75026218 TATCCTAGCACCAGTTGGCTAGG + Intronic
1129473664 15:75768783-75768805 CATCTTGGCCCCAGTGGGTTGGG - Intergenic
1129977938 15:79838164-79838186 TTCCCAAACCCCAGTGGGTTAGG - Intronic
1131094676 15:89647834-89647856 TTTCCTCCCACCAGTGGGTCTGG - Intronic
1133006166 16:2883015-2883037 TATCCCAGCACCAGTGGGTTGGG - Intergenic
1137591429 16:49696503-49696525 TTTTCTACCTCCAGTGGCTTTGG + Intronic
1139530996 16:67542710-67542732 AGTCCTACCCCCAGTGGTATGGG + Exonic
1142376661 16:89710191-89710213 GATCCAACCCCCTGTGGGTGGGG + Intronic
1158407814 18:57175899-57175921 ACTCCTGGCCCCAGTGGGTTGGG - Intergenic
1159474784 18:68906529-68906551 TATACTCATCCCAGTGGGTTTGG + Intronic
1163821048 19:19496747-19496769 CATCCTACTTCCAGTGGGTGGGG - Intronic
1164745700 19:30611143-30611165 TATTCTACCCCCAGAGGGTTTGG - Intronic
1166539246 19:43594712-43594734 GATCCCTCCCCCAGTGAGTTTGG - Intronic
1167149437 19:47700392-47700414 TGATTTACCCCCAGTGGGTTTGG + Intronic
1168280271 19:55302010-55302032 CATCCTGCCCCCGGTGGGGTGGG + Intronic
927192092 2:20523924-20523946 TCTCCTGGCCCCAGTGGGTCTGG - Intergenic
948778634 2:240303402-240303424 TATCCCACCCACAGTGGGAGAGG - Intergenic
1169831561 20:9831038-9831060 TATCCCATGCCCAGTGGGCTGGG + Intronic
1178018634 21:28382274-28382296 AATCCTACCACCTGTGTGTTTGG + Intergenic
952226433 3:31381504-31381526 TATTTTACCCCCACTTGGTTTGG - Intergenic
953530666 3:43737105-43737127 TATCCTATTCCCAGAGGGTGAGG + Intergenic
956002416 3:64743306-64743328 TATCCTATTCCAAGTGGGTGAGG - Intergenic
958968655 3:100586934-100586956 TTTCCTTCTCCCAGTTGGTTTGG - Intergenic
961252155 3:125516485-125516507 TATCCTACCCCAAGAGGTTGTGG - Intronic
965653711 3:170961181-170961203 CACCCTACCCCCATTGGGGTAGG - Intergenic
971002333 4:22337328-22337350 TATCCCACCCCCATTGGTATTGG + Intergenic
973540328 4:51928638-51928660 TTTCCCACCCCCAGTGGCATTGG - Intergenic
980497173 4:133601079-133601101 AATTCAACCCCCAATGGGTTTGG - Intergenic
983760006 4:171394259-171394281 TATCCTTCTCTCAGTTGGTTAGG + Intergenic
985077517 4:186231070-186231092 TATCCTACCCCCTGGGGATTTGG - Intronic
1005070447 6:21857525-21857547 TATCCTATACCCAGTGGGTCAGG - Intergenic
1012805330 6:103886067-103886089 GATTCTACCTCCAGTGGATTTGG - Intergenic
1017906408 6:158760028-158760050 CATCCTTCTCCCAGTGGGGTGGG - Intronic
1023025779 7:36048566-36048588 TCTCCTGCCCTCAGTGGGGTGGG + Intergenic
1023391902 7:39718867-39718889 TATCCAACTCCCAGGGAGTTGGG - Intergenic
1024404815 7:48966496-48966518 GCTCCTACTCCCAGTGAGTTCGG + Intergenic
1024447005 7:49492439-49492461 TAATCAACCCCAAGTGGGTTAGG - Intergenic
1024507327 7:50172949-50172971 ATTAATACCCCCAGTGGGTTAGG - Intergenic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1028638444 7:93016735-93016757 TGTCCTTCACCCAGTGGATTGGG + Intergenic
1028989871 7:97037216-97037238 TAGCCTATCCTCAGTAGGTTAGG + Intergenic
1031691766 7:124797269-124797291 TATCCTTCCCCCAGTGTCCTAGG - Intergenic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1039587801 8:38721087-38721109 TATCAAACCCCGAGTGGGCTAGG + Intergenic
1055142284 9:72889235-72889257 TATCCTACCCCCAGGCGGAAAGG - Intergenic
1055149014 9:72972691-72972713 TATTCTACCCACAGTGGCTTAGG + Intronic
1055698884 9:78919325-78919347 TATCCTACCTCTAGTTAGTTTGG + Intergenic
1059344331 9:113617816-113617838 TATCCTACTCCCAGGGGTTGTGG + Intergenic
1060059264 9:120444462-120444484 TCTCCTACCCCCAGTGCATGAGG + Intronic
1062587084 9:137254279-137254301 GATCCAACCCCCAGCTGGTTCGG - Intergenic
1186483987 X:9918876-9918898 AATCCTAACCCCAATGGGATAGG - Intronic
1187554886 X:20342152-20342174 TACTCTACTCCCAGTGGGTTGGG + Intergenic
1189259250 X:39666475-39666497 TATCTTACCAACAGTGGGTCGGG + Intergenic
1195555078 X:106212311-106212333 TTTCCTTAACCCAGTGGGTTAGG - Intergenic
1196045808 X:111255142-111255164 TTTCCTACTCCCAGTGGGAAAGG - Intronic