ID: 1039554217

View in Genome Browser
Species Human (GRCh38)
Location 8:38465580-38465602
Sequence GGATATGTAAACAAGTCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 169}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039554207_1039554217 7 Left 1039554207 8:38465550-38465572 CCCGGAGCTTCTCCTAACCCACT 0: 1
1: 0
2: 1
3: 20
4: 177
Right 1039554217 8:38465580-38465602 GGATATGTAAACAAGTCATTAGG 0: 1
1: 0
2: 0
3: 9
4: 169
1039554206_1039554217 8 Left 1039554206 8:38465549-38465571 CCCCGGAGCTTCTCCTAACCCAC 0: 1
1: 0
2: 1
3: 6
4: 92
Right 1039554217 8:38465580-38465602 GGATATGTAAACAAGTCATTAGG 0: 1
1: 0
2: 0
3: 9
4: 169
1039554215_1039554217 -10 Left 1039554215 8:38465567-38465589 CCCACTGGGGGTAGGATATGTAA 0: 1
1: 0
2: 0
3: 6
4: 53
Right 1039554217 8:38465580-38465602 GGATATGTAAACAAGTCATTAGG 0: 1
1: 0
2: 0
3: 9
4: 169
1039554214_1039554217 -5 Left 1039554214 8:38465562-38465584 CCTAACCCACTGGGGGTAGGATA 0: 1
1: 0
2: 2
3: 5
4: 74
Right 1039554217 8:38465580-38465602 GGATATGTAAACAAGTCATTAGG 0: 1
1: 0
2: 0
3: 9
4: 169
1039554208_1039554217 6 Left 1039554208 8:38465551-38465573 CCGGAGCTTCTCCTAACCCACTG 0: 1
1: 0
2: 3
3: 17
4: 165
Right 1039554217 8:38465580-38465602 GGATATGTAAACAAGTCATTAGG 0: 1
1: 0
2: 0
3: 9
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039554217 Original CRISPR GGATATGTAAACAAGTCATT AGG Intronic
906810660 1:48823987-48824009 GTATATGTGCACATGTCATTAGG + Intronic
906908789 1:49924383-49924405 ACATATGTAAACATGTCATAGGG - Intronic
907670646 1:56472137-56472159 GGATGTGAAAAGAAGTGATTTGG + Intergenic
911137848 1:94461149-94461171 GGATATGTAACAAAGGCAGTAGG + Intronic
911390715 1:97237783-97237805 GTGTATGTAAAGAAGCCATTGGG - Intronic
911623257 1:100091477-100091499 GGAAATGTAAGCAACTCATAAGG + Intronic
913520902 1:119645486-119645508 GGATATGTACAAAAATAATTAGG + Intronic
914049767 1:144121795-144121817 GTATATGTAGCCAACTCATTTGG - Intergenic
914129415 1:144843656-144843678 GTATATGTAGCCAACTCATTTGG + Intergenic
918286524 1:183060603-183060625 AGACATGTAAACAAATCGTTAGG - Intronic
918734582 1:188042940-188042962 GGCTGTGGAAAGAAGTCATTTGG + Intergenic
918756796 1:188348168-188348190 GGATATGTAATTTAATCATTGGG - Intergenic
921661939 1:217813562-217813584 GTAAATGTAAACAAATAATTAGG + Intronic
923045257 1:230350855-230350877 GGGTATGTGAACAAGTTCTTGGG + Intronic
923638898 1:235731525-235731547 GGAAATGTAAAAAATTAATTTGG - Intronic
1063528140 10:6803531-6803553 GGAAATGTAAACAAGGCAAATGG + Intergenic
1065323183 10:24527746-24527768 GCATAAGTAAACATGTCATATGG + Intronic
1067482457 10:46612211-46612233 GGACATGTAATCAAGACATTTGG + Intergenic
1067612293 10:47729453-47729475 GGACATGTAATCAAGACATTTGG - Intergenic
1068319920 10:55399088-55399110 GTATATGTACAAAATTCATTTGG + Intronic
1068798454 10:61111272-61111294 AGATATGTAAACAGGACTTTTGG + Intergenic
1069165121 10:65146458-65146480 CAATATCTATACAAGTCATTTGG + Intergenic
1071627715 10:87189700-87189722 GGACATGTAATCAAGACATTTGG - Intronic
1073801959 10:107051228-107051250 GGATAAGAAAACAAGGCAGTGGG + Intronic
1075338591 10:121627143-121627165 AGACATATAAACAAGTAATTAGG - Intergenic
1079670761 11:23167825-23167847 GAATATATAAATAAATCATTTGG - Intergenic
1081790572 11:45780750-45780772 GGATATGTTTTCAACTCATTTGG - Intergenic
1084341190 11:68502844-68502866 GGAAATGTCTACTAGTCATTGGG + Intronic
1086413652 11:86567921-86567943 GTGTATGTAAAAAAGTCATGGGG + Intronic
1086756561 11:90571197-90571219 GGATTTGTGAACAAATGATTTGG + Intergenic
1087767972 11:102176995-102177017 CTATATGTAGACAAGTTATTAGG + Intronic
1088477504 11:110258807-110258829 GGATACAAAAACAAGTTATTTGG - Intronic
1090444391 11:126751001-126751023 GGATGTGTACACATGTGATTTGG + Intronic
1091150294 11:133322414-133322436 GGATATGCAAACAAATCGTCTGG + Intronic
1094106261 12:26814854-26814876 TGATTTTTACACAAGTCATTGGG - Intronic
1094575649 12:31682696-31682718 GGATGTGTAAACATTTGATTTGG + Intronic
1094598646 12:31888649-31888671 GGATATGTGAAGAAGTACTTTGG - Intergenic
1099896245 12:88651048-88651070 CAATATGTAAACAAGTGATTTGG - Intergenic
1101007702 12:100417416-100417438 TACTATGTAAACAAGTAATTTGG - Intronic
1101193243 12:102356354-102356376 GGATATGTCAACAAATCTCTGGG + Intergenic
1102851323 12:116248065-116248087 GGAAATCTAAACATGTCATATGG + Intronic
1110543366 13:76729832-76729854 GGATATGAAATTAAGTCATAAGG + Intergenic
1110910971 13:80962640-80962662 GGATAAATAAACAAGTAATATGG - Intergenic
1111687651 13:91521111-91521133 TGAAATGTAAACAAGTGGTTTGG - Intronic
1112964277 13:105167881-105167903 GTATATCTATACAAGTGATTAGG + Intergenic
1113315937 13:109178877-109178899 GGATAATTAATCAAATCATTTGG + Intronic
1115094071 14:29613730-29613752 TGATATGTTACCAAGTCAGTTGG - Intronic
1117306070 14:54474357-54474379 GGCAAAATAAACAAGTCATTTGG - Intergenic
1118237254 14:64018938-64018960 TAATATGTAAACAAGCAATTAGG - Intronic
1118995091 14:70828333-70828355 GGAAATCTACACAAGGCATTTGG + Intergenic
1119815414 14:77562153-77562175 GGATCTGTAAACAAGGAAATGGG + Intronic
1123419632 15:20121036-20121058 GTATATGTAGCCAACTCATTTGG - Intergenic
1123446232 15:20332500-20332522 GTATATGTAGCCAACTCATTTGG + Intergenic
1123528855 15:21127572-21127594 GTATATGTAGCCAACTCATTTGG - Intergenic
1125067789 15:35511144-35511166 GAATATGCAAACAGATCATTTGG - Intronic
1126535463 15:49757328-49757350 GGATGTCAAAACAATTCATTAGG + Intergenic
1129634391 15:77299383-77299405 GGAATTATAAACAAGTTATTAGG - Intronic
1134399291 16:13893921-13893943 GGAGATTGAAACCAGTCATTAGG + Intergenic
1135094854 16:19556280-19556302 GGATGTCTAAAGAAGGCATTCGG + Intronic
1138078036 16:54062178-54062200 GGAAATGATTACAAGTCATTTGG + Intronic
1140246727 16:73256852-73256874 GGACATGTACACAAGTAAGTAGG + Intergenic
1203137453 16_KI270728v1_random:1737704-1737726 GTATATGTAGCCAACTCATTCGG + Intergenic
1144049128 17:11482807-11482829 CTGTATGTAAATAAGTCATTAGG + Intronic
1144724392 17:17494612-17494634 TCACATGTAAACAAGTCACTTGG + Exonic
1145404691 17:22576965-22576987 TGATATGTAAACTAGTAATTTGG + Intergenic
1151160171 17:72158596-72158618 GGAAATGAAAACAATTCAATGGG - Intergenic
1151872298 17:76844613-76844635 GGATATGGAGACAAGTCACCAGG + Intergenic
1156540974 18:37909969-37909991 AGGTATGTAAATAAGCCATTTGG + Intergenic
1159316897 18:66787175-66787197 GCATATGTAAAAAATACATTTGG - Intergenic
1165682108 19:37786455-37786477 AGATATGTTTTCAAGTCATTTGG - Intronic
1202689156 1_KI270712v1_random:74358-74380 GTATATGTAGCCAACTCATTTGG - Intergenic
926815736 2:16796591-16796613 GGGTATGGAAATAAGTGATTGGG + Intergenic
927399329 2:22692800-22692822 GGGTATGTGGAGAAGTCATTAGG + Intergenic
930137812 2:47920154-47920176 AGATGAGTAAACAAATCATTAGG - Intergenic
930488262 2:52036069-52036091 GAAAAAGTAACCAAGTCATTAGG + Intergenic
930568474 2:53053577-53053599 GGAAATGTAGAAAAGACATTAGG - Intergenic
931682660 2:64764898-64764920 GGAATTGAAAACAAATCATTTGG + Intergenic
931942187 2:67264677-67264699 GGAGATATAATCAAATCATTAGG + Intergenic
932380271 2:71276166-71276188 AGATATGAAAACAGGTAATTAGG - Intergenic
933957282 2:87381733-87381755 GTATATGTAGCCAATTCATTTGG + Intergenic
934241399 2:90273625-90273647 GTATATGTAGCCAACTCATTTGG + Intergenic
934271775 2:91543061-91543083 GTATATGTAGCCAACTCATTTGG - Intergenic
937642726 2:124231696-124231718 GGATATTTAAACAATGCCTTAGG + Intronic
937768033 2:125684639-125684661 GGGCATGTGATCAAGTCATTTGG - Intergenic
940842382 2:158598843-158598865 GGGTATATAAACAAGTTATATGG + Intronic
941273842 2:163465017-163465039 GGATATGCAAACTATTCATATGG - Intergenic
942510132 2:176689307-176689329 ACATATGTAAAAAATTCATTGGG + Intergenic
942928648 2:181462814-181462836 GGATATATTTTCAAGTCATTGGG - Intronic
943015440 2:182504527-182504549 GTATATATAATAAAGTCATTTGG + Intronic
943404253 2:187460434-187460456 GGTTATATAAACAAGTTTTTTGG - Intergenic
943422797 2:187690028-187690050 GAAAATGTAAAGAAGTCTTTCGG - Intergenic
944330696 2:198462823-198462845 AGAAATGTAAACAAATCATAAGG - Intronic
948679478 2:239623183-239623205 GGGTATATAAACAAATCATTTGG - Intergenic
1169782455 20:9324010-9324032 GGAAATGTGAGCAATTCATTAGG - Intronic
1170321812 20:15108414-15108436 GGATATGTAAACAGTTGTTTTGG - Intronic
1172791261 20:37507038-37507060 GGAGATTTAAACAAGAGATTTGG - Intronic
1175666435 20:60864043-60864065 GGATATTTACAGACGTCATTTGG + Intergenic
1178780136 21:35594918-35594940 GCAAATGTAAACAAGCTATTTGG + Intronic
1180552269 22:16550256-16550278 GTATATGTAGCCAACTCATTCGG + Intergenic
1181351760 22:22263786-22263808 GTATATGTAGCCAACTCATTTGG - Intergenic
1182892856 22:33833342-33833364 GGATCTTTAAAGAAGTTATTAGG + Intronic
1184846906 22:47093598-47093620 GAATATTTAAACCAGTCAATTGG + Intronic
950805073 3:15594748-15594770 TTAAATGTAAACAAGTCATACGG + Intronic
953144302 3:40260371-40260393 GGATAGGGAAAGAAGTCATGTGG + Intergenic
953878120 3:46677889-46677911 GGATATGTAGACATGTCCTACGG - Intronic
955531492 3:59877530-59877552 GGACATGTAAACAAGCCCTATGG + Intronic
956550801 3:70456790-70456812 TCATCTGTAAACAAGTCATATGG - Intergenic
957981026 3:87510683-87510705 GGATGTGTAAATACATCATTTGG - Intergenic
959720017 3:109475933-109475955 GGATATAAAAACAATTCAGTGGG - Intergenic
960678818 3:120225665-120225687 GCATAAAAAAACAAGTCATTAGG - Intronic
965250518 3:166337832-166337854 AGATTGGTAGACAAGTCATTTGG - Intergenic
967011012 3:185433936-185433958 GGATTTTTAAACAAATTATTTGG + Intronic
973866832 4:55123183-55123205 GAAAATGAAAACAATTCATTTGG + Intronic
974638249 4:64593043-64593065 GGATATTTATACAAATCCTTTGG + Intergenic
976043507 4:80916428-80916450 TGAAATGTAGACAAGTTATTGGG + Intronic
977589386 4:98809589-98809611 AGAAAAATAAACAAGTCATTGGG + Intergenic
978875847 4:113639432-113639454 GGATATGTAAATAAGTAATGTGG + Intronic
979521050 4:121666760-121666782 AGATATGGAAACAAATCATTTGG - Intergenic
980696253 4:136360549-136360571 AGATATGTGAAACAGTCATTTGG - Intergenic
984123472 4:175775625-175775647 GAATATGAAAGCAAGGCATTTGG - Intronic
984207670 4:176805602-176805624 GAATAATTAAACAACTCATTGGG - Intergenic
986555766 5:9008640-9008662 GGATATGGAAATAAGGGATTGGG + Intergenic
987530727 5:19115624-19115646 GGAGATGTGATAAAGTCATTTGG - Intergenic
988590430 5:32544222-32544244 GCATATGTAAACAATTCACGTGG - Intronic
992145573 5:73844011-73844033 GGATAAGAAATCAATTCATTAGG - Intronic
992593361 5:78319356-78319378 AGATATGAAAATAAGTCATGGGG - Intergenic
993486464 5:88493529-88493551 GGATTTGAAACCAAGTCTTTAGG + Intergenic
994155762 5:96502820-96502842 GGATATTTAAAGAAGTGAGTTGG - Intergenic
995958362 5:117808351-117808373 GGAAATGTTCTCAAGTCATTTGG + Intergenic
996055825 5:118981393-118981415 GTTTATGTAGACAAGTTATTTGG - Intronic
998675762 5:144406123-144406145 GGTTATCTAAATAAGTCCTTCGG - Intronic
999492892 5:152069000-152069022 GGATAAGTAAATGATTCATTGGG + Intergenic
1001442940 5:171759609-171759631 GGAAGTGTAAAAAAGTGATTTGG + Intergenic
1003211272 6:4069477-4069499 GGATATGGAAATACTTCATTTGG + Exonic
1008461121 6:51773623-51773645 GGATATGCAGACAATACATTTGG - Intronic
1008884418 6:56416826-56416848 TTATATTTAAAAAAGTCATTTGG - Intergenic
1008947264 6:57111941-57111963 GTATTTGTAAACAACTAATTGGG + Intronic
1009365928 6:62857777-62857799 GGATATTAAAAAAAGTCATAGGG - Intergenic
1009649625 6:66457937-66457959 GGATTTGTAAACACATTATTGGG + Intergenic
1009850003 6:69184022-69184044 GGATATGTAAACAAATGAGAGGG + Intronic
1011380952 6:86741624-86741646 GGAGATGCACACAAGTCATAAGG - Intergenic
1011796444 6:90958754-90958776 GGATTTGTGTAAAAGTCATTAGG - Intergenic
1012629138 6:101441934-101441956 GGATATGTATACTTGTCTTTTGG + Intronic
1013144904 6:107379095-107379117 GGGTATCTATACAAATCATTTGG + Intronic
1013416578 6:109931051-109931073 GGATATGGAGACAGGTCACTTGG + Intergenic
1014914866 6:127134551-127134573 ATATATGTCAACAAGTTATTTGG + Intronic
1015027880 6:128558723-128558745 TGATATGAAAACATGTCATAAGG + Intergenic
1016180310 6:141138261-141138283 GGATGAATAAACAAATCATTCGG + Intergenic
1017335986 6:153260597-153260619 CGATATGTAAAAAAGACATAGGG + Intergenic
1021399502 7:20193712-20193734 GGAAAAATAAACATGTCATTAGG + Intronic
1027559833 7:79715360-79715382 GGATATGTAATCATGTAATCAGG - Intergenic
1027705429 7:81527709-81527731 TGATAATTAAACTAGTCATTGGG - Intergenic
1028633762 7:92964312-92964334 GGAAATAAAACCAAGTCATTTGG - Intergenic
1031940726 7:127786340-127786362 AGATAAGTAAAGAAGTCATCTGG + Intronic
1034054717 7:148022122-148022144 TTATATGTAAACCTGTCATTAGG + Intronic
1036055135 8:5243784-5243806 GCATATGTCCAAAAGTCATTCGG - Intergenic
1038984208 8:32791235-32791257 GGACATGTAAATATGTCACTGGG - Intergenic
1039447629 8:37645367-37645389 TGATATGTAAAGAAGTCAATAGG + Intergenic
1039554217 8:38465580-38465602 GGATATGTAAACAAGTCATTAGG + Intronic
1040767507 8:50931565-50931587 GGAAATGCATGCAAGTCATTTGG + Intergenic
1045830175 8:106449674-106449696 GGAATTTTAAACAAGTAATTTGG - Intronic
1047471532 8:125178564-125178586 AGGTATTTAAAGAAGTCATTAGG + Intronic
1047997415 8:130349957-130349979 ATATATGTAACCTAGTCATTTGG - Intronic
1050723357 9:8617048-8617070 GGATTTGTAAATAAGTATTTTGG - Intronic
1051347850 9:16168657-16168679 GAACATCTCAACAAGTCATTGGG - Intergenic
1052425125 9:28294115-28294137 TTATATGCAAATAAGTCATTAGG + Intronic
1055431636 9:76249984-76250006 GAATATTTAAATAAGTTATTTGG - Intronic
1055699957 9:78933224-78933246 GGATTTGTTAAGAAGTAATTGGG + Intergenic
1056226865 9:84504465-84504487 GGAAATGTTAACCAGTCTTTTGG - Intergenic
1056674377 9:88661746-88661768 GAATATGTAAAGAACTCAGTAGG + Intergenic
1059914127 9:119079386-119079408 TAATATATAAAAAAGTCATTGGG + Intergenic
1187951129 X:24471868-24471890 GGAAATGTAAACAAGAAAATAGG - Intronic
1188240869 X:27787916-27787938 GGATATGAAACCAAATTATTTGG - Intergenic
1189862286 X:45285970-45285992 AGATATGGAATCAAGTGATTAGG + Intergenic
1190006780 X:46747785-46747807 GGAAATACAAATAAGTCATTAGG + Intronic
1193946527 X:87742866-87742888 GGAGATGTAATTAAGTCATGAGG - Intergenic
1195780450 X:108457162-108457184 ATATTTGTAAACAAGTCTTTGGG + Intronic
1198620123 X:138498834-138498856 GCAGATGTAATCAAGACATTAGG + Intergenic
1201621129 Y:15959453-15959475 GTCTATGTAAATAATTCATTTGG + Intergenic