ID: 1039554219

View in Genome Browser
Species Human (GRCh38)
Location 8:38465584-38465606
Sequence ATGTAAACAAGTCATTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 204}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039554214_1039554219 -1 Left 1039554214 8:38465562-38465584 CCTAACCCACTGGGGGTAGGATA 0: 1
1: 0
2: 2
3: 5
4: 74
Right 1039554219 8:38465584-38465606 ATGTAAACAAGTCATTAGGGAGG 0: 1
1: 0
2: 0
3: 17
4: 204
1039554215_1039554219 -6 Left 1039554215 8:38465567-38465589 CCCACTGGGGGTAGGATATGTAA 0: 1
1: 0
2: 0
3: 6
4: 53
Right 1039554219 8:38465584-38465606 ATGTAAACAAGTCATTAGGGAGG 0: 1
1: 0
2: 0
3: 17
4: 204
1039554208_1039554219 10 Left 1039554208 8:38465551-38465573 CCGGAGCTTCTCCTAACCCACTG 0: 1
1: 0
2: 3
3: 17
4: 165
Right 1039554219 8:38465584-38465606 ATGTAAACAAGTCATTAGGGAGG 0: 1
1: 0
2: 0
3: 17
4: 204
1039554216_1039554219 -7 Left 1039554216 8:38465568-38465590 CCACTGGGGGTAGGATATGTAAA 0: 1
1: 0
2: 0
3: 8
4: 76
Right 1039554219 8:38465584-38465606 ATGTAAACAAGTCATTAGGGAGG 0: 1
1: 0
2: 0
3: 17
4: 204
1039554207_1039554219 11 Left 1039554207 8:38465550-38465572 CCCGGAGCTTCTCCTAACCCACT 0: 1
1: 0
2: 1
3: 20
4: 177
Right 1039554219 8:38465584-38465606 ATGTAAACAAGTCATTAGGGAGG 0: 1
1: 0
2: 0
3: 17
4: 204
1039554206_1039554219 12 Left 1039554206 8:38465549-38465571 CCCCGGAGCTTCTCCTAACCCAC 0: 1
1: 0
2: 1
3: 6
4: 92
Right 1039554219 8:38465584-38465606 ATGTAAACAAGTCATTAGGGAGG 0: 1
1: 0
2: 0
3: 17
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039554219 Original CRISPR ATGTAAACAAGTCATTAGGG AGG Intronic
903820800 1:26101037-26101059 ATGTGATTAAGTCATGAGGGTGG + Intergenic
905715307 1:40144353-40144375 ATGAAAAGAAGTCATTCTGGAGG - Intergenic
909306578 1:74087800-74087822 AGGTAAAAAAGTCATCAGGCTGG + Intronic
911390714 1:97237779-97237801 ATGTAAAGAAGCCATTGGGTTGG - Intronic
916456945 1:164980808-164980830 AGGTAATCAGGTCATAAGGGTGG - Intergenic
916918032 1:169431160-169431182 ATGTACACAAATCAGTAGTGAGG - Intronic
917265896 1:173220593-173220615 ATGTAATTAGGTCATGAGGGTGG + Intergenic
918133981 1:181653844-181653866 ATGTGAACAAATCTTTTGGGGGG + Intronic
918488170 1:185051620-185051642 ATTTAAAAAAGTGTTTAGGGTGG + Intronic
920911778 1:210225126-210225148 ATGGCACCAAGTCATTAGTGAGG - Intergenic
920947131 1:210540097-210540119 GAGTAACCAAGTCATCAGGGTGG - Intronic
921230078 1:213061117-213061139 AGGTAATCAGGTCATGAGGGTGG - Intronic
921330841 1:214033856-214033878 ATGTATACAAGACATTTGGGAGG + Intronic
921410816 1:214834892-214834914 AAGTTAAGATGTCATTAGGGTGG + Intergenic
921779632 1:219147151-219147173 AGGTACTCAGGTCATTAGGGTGG - Intergenic
1064642319 10:17427248-17427270 ATGTATCAAAGTCATTAGGAGGG + Intronic
1065226451 10:23548526-23548548 ATTAAAACAAATCATTAGGCTGG + Intergenic
1067427459 10:46220746-46220768 ATTAAACAAAGTCATTAGGGTGG + Intergenic
1067482459 10:46612215-46612237 ATGTAATCAAGACATTTGGGAGG + Intergenic
1067582890 10:47456656-47456678 ATTAAACAAAGTCATTAGGGTGG + Intergenic
1067612291 10:47729449-47729471 ATGTAATCAAGACATTTGGGAGG - Intergenic
1068253592 10:54477071-54477093 ATGTAAATAAATTATCAGGGAGG - Intronic
1070844385 10:79510036-79510058 AAGTAACCAAGACATCAGGGTGG + Intergenic
1070929412 10:80250272-80250294 AAGTAACCAAGACATCAGGGTGG - Intergenic
1071060405 10:81564108-81564130 ATGTAAACTAGTAATGAGAGAGG + Intergenic
1071089535 10:81902415-81902437 ATGTAATTAGGTCATGAGGGTGG + Intronic
1071627714 10:87189696-87189718 ATGTAATCAAGACATTTGGCAGG - Intronic
1074460260 10:113630179-113630201 AGGGAAACAAGTCCTTAGAGAGG - Intronic
1074615444 10:115062873-115062895 ATGTAAAGAATTCATTAGATTGG + Intergenic
1075786193 10:125051819-125051841 AATTAAACAGGTCATTAGAGTGG + Intronic
1076393947 10:130124836-130124858 AGGTAATCAAGTCATGGGGGTGG + Intergenic
1077542706 11:3154947-3154969 ATTAAAACAGGTCATTAGGGTGG + Intronic
1079907303 11:26264825-26264847 ATGGAATAAAGTCATTAGGGTGG - Intergenic
1081056793 11:38419394-38419416 ATGTAAACTAGTAAATAGGATGG - Intergenic
1085947927 11:81294608-81294630 ATGTAAACATGTCATTGTGGTGG + Intergenic
1089934904 11:122354226-122354248 ATGAAGACAAGTTATTATGGTGG - Intergenic
1091298639 11:134490521-134490543 AGGTAATCAGGTCATCAGGGAGG - Intergenic
1091481461 12:836130-836152 ATGTAATGAAGTAATTAGGGAGG + Intronic
1091499067 12:997969-997991 ATGATAACAAGCCAATAGGGTGG - Intronic
1091811994 12:3407210-3407232 AGGTAATCAAATCATGAGGGTGG - Intronic
1093553681 12:20445995-20446017 ATGGAAACATGACATTTGGGTGG + Intronic
1095502109 12:42851240-42851262 CAGTAAAGCAGTCATTAGGGAGG + Intergenic
1098771247 12:74556301-74556323 AGGTAAATGAGACATTAGGGAGG - Intergenic
1098796671 12:74897519-74897541 ATGAAAACAAGTCATAAGCCAGG - Intergenic
1098940038 12:76523559-76523581 AGGTAATCATGTCATGAGGGTGG + Intronic
1099987449 12:89684015-89684037 ATGTCTACAAGTCAATATGGTGG + Intronic
1101671935 12:106883717-106883739 AGATAGACAAGTCATTAGGGGGG - Intronic
1105605376 13:21922297-21922319 ATGTAAACAAGGCTTCAGAGAGG + Intergenic
1106806045 13:33308445-33308467 AAATAAACAAGTAATTAGTGGGG - Intronic
1108751735 13:53454638-53454660 TTGTAAACAGCTCCTTAGGGTGG + Intergenic
1109214186 13:59568876-59568898 ATGTAATCAGGTCATGAGGGTGG + Intergenic
1110495973 13:76168372-76168394 AGGTAATCAGGTCATAAGGGTGG - Intergenic
1111293460 13:86198658-86198680 GTGTAATTAAGTCATGAGGGTGG + Intergenic
1114220817 14:20694619-20694641 GTTTTTACAAGTCATTAGGGAGG + Intronic
1114225625 14:20735793-20735815 ATGAAAACAAGTCATGAGGTTGG - Intronic
1117754279 14:58957947-58957969 ATGTAATTAGGTCATGAGGGTGG + Intergenic
1120456194 14:84733171-84733193 AAGTAAACAAGTCAATATGATGG - Intergenic
1120640643 14:87007545-87007567 ATGGAAACAAGGCACTTGGGGGG + Intergenic
1122536457 14:102467129-102467151 ATGTGTGCAAGTCTTTAGGGAGG + Intronic
1126981189 15:54245184-54245206 ATGTATACAAGTGATGAGAGTGG - Intronic
1127152473 15:56091510-56091532 ATGTAAACAAGGGATTAGAATGG + Exonic
1128712585 15:69883466-69883488 AGGTGAATAAGTCATGAGGGTGG - Intergenic
1129240727 15:74250547-74250569 ATGAAAACATGTAATGAGGGAGG - Intronic
1129935818 15:79449570-79449592 ATGAAACCCATTCATTAGGGAGG + Intronic
1131241430 15:90747089-90747111 AAGTACAAAAGACATTAGGGAGG - Intronic
1135271817 16:21076196-21076218 ATTAAAATAAGTCATGAGGGTGG + Intronic
1135930988 16:26736468-26736490 ATGTCAACAACTCAGGAGGGAGG + Intergenic
1138969456 16:62127444-62127466 ATGTAATTAGGTCATGAGGGTGG - Intergenic
1140674669 16:77316222-77316244 ATGTAAATAAGTGATTGGAGAGG - Intronic
1141366478 16:83448237-83448259 ATGTAAAGAAATCAGTAAGGAGG + Intronic
1154052587 18:10974972-10974994 CTCTAAACAAGTCCTCAGGGTGG - Intronic
1155460572 18:26077325-26077347 ATGTAAACTGGTAATTAGAGAGG - Intronic
1156889010 18:42168336-42168358 ATGAAATGAAGTCATTAGTGTGG - Intergenic
1156985631 18:43347766-43347788 ATGTAGGCAAGTAATTTGGGAGG + Intergenic
1159502051 18:69285775-69285797 ATGTAAAGAAGTCCTTTGTGGGG - Intergenic
1159600512 18:70424431-70424453 AAGTAAACATGAGATTAGGGTGG - Intergenic
1160480153 18:79232515-79232537 AAGTAAACAAGCCTTTAGTGTGG - Intronic
1164437976 19:28248722-28248744 ATGTAAACATGCAATTAAGGAGG - Intergenic
1164512844 19:28911602-28911624 ATCTTAGCAAGTCTTTAGGGAGG - Intergenic
1164705467 19:30316400-30316422 ATTTATAGAAGTCATTAGAGTGG - Intronic
1167683051 19:50937408-50937430 ATATAAATAAATCATTTGGGAGG - Intergenic
1167737450 19:51304546-51304568 ATGTAAAACAGGAATTAGGGAGG + Intergenic
1167897254 19:52592063-52592085 ATTTCAACAAAACATTAGGGAGG - Intergenic
1167905317 19:52655704-52655726 ATTTCAACAAAACATTAGGGAGG + Intronic
924987207 2:282931-282953 CTGTAGACAAGCCAGTAGGGTGG + Intronic
926336606 2:11867388-11867410 ATGTAATTAGGTCATGAGGGTGG - Intergenic
927417615 2:22895135-22895157 ATGTAAAAAAGTCACTAATGAGG - Intergenic
928302747 2:30141078-30141100 AGGTAATCAGGTCATGAGGGTGG + Intergenic
928354877 2:30602641-30602663 AAGAAAAAAAGTCATTAGGAAGG - Intronic
939029859 2:137059235-137059257 ATGTAATCAGGTCATGAGAGTGG - Intronic
940200712 2:151147095-151147117 ATGCTAACAAGCCTTTAGGGAGG + Intergenic
942418835 2:175786663-175786685 ATGTAAACAATACAGAAGGGTGG + Intergenic
942740466 2:179170825-179170847 ATGTACACAGGCCATGAGGGTGG + Intronic
944299524 2:198107259-198107281 AGGTAATCAAATCATAAGGGAGG - Intronic
944423534 2:199556289-199556311 ATGTAGAAAAGTTATTAGGATGG + Intergenic
946521681 2:220471848-220471870 AGGTAATCAGGTCATAAGGGTGG + Intergenic
946922233 2:224591877-224591899 TTGTAAACAAGCCCTTAGAGTGG + Intergenic
947113725 2:226747344-226747366 AGGTAATTAAGTCATGAGGGTGG + Intronic
948679477 2:239623179-239623201 ATATAAACAAATCATTTGGCCGG - Intergenic
1172053703 20:32139403-32139425 CTGTAAACAAGGCATGAGTGAGG - Intronic
1172202822 20:33138923-33138945 AAGGAAACAAGTCATTTGGAGGG + Intergenic
1173942396 20:46922585-46922607 AGGTAAATAAGTAAATAGGGAGG + Intronic
1175007739 20:55703384-55703406 ATGTAAACAAATTATGAGTGTGG - Intergenic
1176267613 20:64218755-64218777 ATGCAGACAAGTCAGTGGGGAGG - Intronic
1176937284 21:14882061-14882083 ATGTGATTAAGTCATGAGGGTGG - Intergenic
1177154498 21:17487348-17487370 ATGTACACAAATCATAAGTGTGG - Intergenic
1177588247 21:23127292-23127314 ATGAAAACAGGACATTATGGTGG - Intergenic
1182827608 22:33279282-33279304 ATGAAAACAAGACAGAAGGGTGG + Intronic
949490425 3:4583853-4583875 GTGTAAACATCTCATTAGTGAGG - Intronic
950641237 3:14349833-14349855 TTGAAACAAAGTCATTAGGGTGG + Intergenic
950744591 3:15076967-15076989 AAGTAAACAAGTCATTGGCATGG + Intronic
952034909 3:29188583-29188605 TTGTAAACAAGTTTCTAGGGAGG - Intergenic
953065367 3:39464841-39464863 AAGTTATGAAGTCATTAGGGTGG - Intergenic
954714810 3:52521723-52521745 ATGTACACAAGTGTGTAGGGTGG - Intronic
955391780 3:58527187-58527209 AGGTAATTAAGTCATGAGGGTGG + Intronic
957958860 3:87224697-87224719 ATGTGATTAAGTCATGAGGGTGG + Intergenic
958580968 3:96022757-96022779 ATGAAATGAAGTCATTAGGAGGG + Intergenic
958746418 3:98140901-98140923 ATCTACAGAAGTAATTAGGGAGG - Intergenic
960003471 3:112757125-112757147 TTGTATACAAGTCTTTATGGGGG + Intronic
960574162 3:119213291-119213313 ATTTAAAGAAGTCACTAGTGTGG + Intronic
961008535 3:123421042-123421064 ATGTTAAGATGTCATCAGGGTGG - Intronic
963512728 3:146269004-146269026 AGGTAATTAAGTCATGAGGGTGG + Intergenic
964083083 3:152784371-152784393 ATGAAAAAAATTCATTAGTGTGG - Intergenic
964172734 3:153790131-153790153 TTGTAAACATGTCAGTAGAGTGG - Intergenic
964865713 3:161258104-161258126 ATTTAAAAAAGTCATTTAGGAGG - Intergenic
966337148 3:178881040-178881062 ATATAAGCAAGTCACTAGGGAGG - Intergenic
970587068 4:17524520-17524542 ATGTAAACAATTCTACAGGGTGG - Intronic
972060031 4:34858190-34858212 AGGTAATTAAGTCATAAGGGTGG + Intergenic
972350716 4:38233885-38233907 ATGTAAAGAGGCCATTTGGGTGG + Intergenic
972392967 4:38631004-38631026 ATGTAAAGAAGTCATTTGCAAGG + Intergenic
973609790 4:52624734-52624756 AGGCAAACAGGTCATGAGGGTGG + Intronic
977098212 4:92772450-92772472 TTGTATACAATTCATTAAGGTGG - Intronic
977759019 4:100708370-100708392 CTGTAACCAAGACATCAGGGTGG + Intronic
979894154 4:126136651-126136673 ATGTAAACAAGTCATATGCAGGG + Intergenic
980198323 4:129620836-129620858 ATGAAAACAGGTCAGTAGGAAGG - Intergenic
980365598 4:131800769-131800791 ATGTAAATAAGTAAATAGAGAGG + Intergenic
981272063 4:142856920-142856942 AAGTAATTAAGTCATGAGGGTGG - Intergenic
981577663 4:146222230-146222252 AAGTGAACAATTCATTAGAGGGG - Intergenic
982547920 4:156758813-156758835 AGGTAATCAGGTCATGAGGGTGG + Intergenic
983965927 4:173809769-173809791 ATATAAAAAATTTATTAGGGTGG + Intergenic
984053435 4:174895942-174895964 AAGTAATGATGTCATTAGGGTGG + Intronic
984633756 4:182088968-182088990 AGGTAATCAAGTCATGAGGGCGG + Intergenic
987432998 5:17859741-17859763 ATGTAATTAGGTCATGAGGGTGG - Intergenic
989453472 5:41614337-41614359 ATTTAAAATAGTCATTATGGAGG - Intergenic
990201208 5:53377021-53377043 ATGTAAACAAGGTTTCAGGGGGG + Intergenic
990786459 5:59425989-59426011 ATTTAAATAAGCCTTTAGGGTGG + Intronic
992687903 5:79216051-79216073 ATGTAGACAATTCATTTGAGAGG - Intronic
992919142 5:81494474-81494496 AAGTAATTAAGTCATGAGGGTGG + Intronic
995563497 5:113408720-113408742 ATGTAGACAAATCATCAAGGTGG + Intronic
996452800 5:123646041-123646063 ATATGAACAAGTGATTATGGAGG - Intergenic
996959450 5:129229041-129229063 AAGTACACATGTCGTTAGGGTGG - Intergenic
997125550 5:131223503-131223525 ATGGTAACAAGTAATTTGGGTGG - Intergenic
999711162 5:154319816-154319838 ATGTAGACAAGTCTTAAGTGGGG + Intronic
999791287 5:154941573-154941595 ATGTAAGCAAGTAATCAGAGAGG - Intronic
1000267691 5:159653452-159653474 ATGAAGACAAGCCTTTAGGGAGG + Intergenic
1001764955 5:174238456-174238478 AGGTAGCCAAGTCCTTAGGGAGG + Intronic
1002942040 6:1725795-1725817 ATGTAAACAAATGATTATGGTGG + Intronic
1003043400 6:2710565-2710587 ATGTAAAACAGGAATTAGGGAGG - Intronic
1004482804 6:16037233-16037255 AAGTAAATAAGTAATTATGGAGG + Intergenic
1008766128 6:54917434-54917456 ATGTAAAGAAGACATTGGGAAGG - Intronic
1009553400 6:65129718-65129740 ATGTAAATAAGTCACTGGAGGGG + Intronic
1009999560 6:70934719-70934741 ACGTAAAGAAGTAATTAAGGTGG - Intronic
1010165569 6:72911270-72911292 AGGTAATTAAGCCATTAGGGTGG + Intronic
1010653949 6:78489613-78489635 ATGTAAACATGTCAGCAGGGTGG - Intergenic
1010779135 6:79923641-79923663 ATGTAAACAAATGACTAAGGAGG - Intronic
1012116924 6:95311742-95311764 ATGTAAACCATTCATTAATGTGG + Intergenic
1013414189 6:109909974-109909996 ATGTTAAGATGTCATTAGTGTGG - Intergenic
1014069706 6:117167348-117167370 ATATAAACAGGAAATTAGGGAGG - Intergenic
1015102188 6:129494576-129494598 ATGTAAATAAAACAATAGGGTGG - Intronic
1015457008 6:133437833-133437855 AGGTAATCAAGTCATAGGGGCGG - Intronic
1015573038 6:134641699-134641721 ATGTAAATAAGACCTTAGAGGGG - Intergenic
1015807439 6:137125322-137125344 AGGTGAATAAATCATTAGGGTGG - Intergenic
1016595119 6:145790158-145790180 AGGTAAACGAATCATGAGGGTGG - Intergenic
1017689636 6:156950934-156950956 TTTTAAAAAATTCATTAGGGAGG - Intronic
1019207948 6:170378428-170378450 ACGGAAACAAGTCCTCAGGGAGG - Intronic
1021101919 7:16594072-16594094 AGGTAAATAGGTCATGAGGGTGG + Intergenic
1021399503 7:20193716-20193738 AAATAAACATGTCATTAGGAAGG + Intronic
1022879032 7:34566647-34566669 AGGTAAAGCAGTGATTAGGGTGG - Intergenic
1024012084 7:45276742-45276764 ATGTAAACAAATCATCAGTAAGG - Intergenic
1024509036 7:50188333-50188355 AGGTGATCAAGTCATGAGGGTGG + Intergenic
1026504050 7:70967330-70967352 ATGAAAACAAATCACTGGGGTGG - Intergenic
1028397893 7:90392512-90392534 AAGTTAAAATGTCATTAGGGTGG - Intronic
1030247783 7:107403738-107403760 AGGTAAACAGGTCATGAAGGTGG - Intronic
1032397158 7:131598863-131598885 ATGTAATCAGATCATTACGGTGG - Intergenic
1036055131 8:5243780-5243802 ATGTCCAAAAGTCATTCGGGGGG - Intergenic
1036911434 8:12760505-12760527 AAGTAATCAGGTCATTAAGGTGG + Intergenic
1037778534 8:21851596-21851618 AAGAAAACAAGTCATTGGGGTGG + Intergenic
1038178986 8:25208889-25208911 ATATTCACAAGTCATTTGGGAGG - Intronic
1038181461 8:25232680-25232702 AGGTAATTAAGTCATGAGGGTGG - Intronic
1038988291 8:32837408-32837430 ATGTAAATAAGTAATAAGGACGG - Intergenic
1039031826 8:33317617-33317639 TTGTAAGCAAGCCATCAGGGAGG + Intergenic
1039406477 8:37317059-37317081 ATGTAAACTAGGTATTAGGATGG + Intergenic
1039554219 8:38465584-38465606 ATGTAAACAAGTCATTAGGGAGG + Intronic
1042923837 8:73946946-73946968 ATTAAAAGAGGTCATTAGGGTGG + Intronic
1043707024 8:83362859-83362881 ATGCAAACAATTCAATAGGAAGG + Intergenic
1044543383 8:93432149-93432171 ATGTAAACATATCCTTTGGGGGG + Intergenic
1045865655 8:106862458-106862480 AAGTAAACAAGTCGTTTGGGAGG - Intergenic
1046290417 8:112152452-112152474 ATATATACAAATCATTTGGGAGG - Intergenic
1046419764 8:113964917-113964939 AGGTAATTAAGTCATGAGGGTGG + Intergenic
1047387373 8:124422512-124422534 TTGTAAACAAGTAATTATAGTGG + Intergenic
1047471533 8:125178568-125178590 ATTTAAAGAAGTCATTAGGTTGG + Intronic
1047999871 8:130369954-130369976 AGGTAATTAAGTCATGAGGGTGG + Intronic
1048637342 8:136311656-136311678 ATGGAACCAAGTCATTCGTGAGG + Intergenic
1050116906 9:2272364-2272386 GTGAAAACAAGTCATTGGGAAGG - Intergenic
1050153322 9:2639340-2639362 AGGTAATTAAGTCATGAGGGTGG - Intronic
1052234408 9:26192615-26192637 ATTAAAATAAGTTATTAGGGTGG + Intergenic
1052631709 9:31049725-31049747 ATGTAAACAGGTAAATAGTGGGG - Intergenic
1058823127 9:108750942-108750964 GTGTAAACAAGATTTTAGGGGGG - Intergenic
1059916526 9:119109276-119109298 GTGAAAACAAATCATTAGGTGGG - Intergenic
1185511754 X:668855-668877 ATGTAAAAAATTAATTAGGCTGG - Intergenic
1188528987 X:31117042-31117064 ATGTAAACAATTCATTAACCTGG + Intronic
1188848066 X:35098660-35098682 GTGTAAATAATTCATTAGGCAGG + Intergenic
1188941209 X:36240115-36240137 ATGAAAACAAACCATTAGGAGGG + Intronic
1188975523 X:36669399-36669421 GTGTAAATAATTCATTAGGCAGG - Intergenic
1189009861 X:37036270-37036292 AGGTAATCAGGTCACTAGGGCGG - Intergenic
1191716793 X:64199206-64199228 ATGTAAACAAATCAGTTGAGAGG - Intronic
1193602294 X:83522374-83522396 ACCTAAACCACTCATTAGGGTGG + Intergenic
1193751380 X:85349503-85349525 AGATAATCAAGTCATTAGGATGG + Intronic
1194818323 X:98473165-98473187 AGGTAAATAGGTCATGAGGGTGG - Intergenic
1198611340 X:138404444-138404466 ATGAAAACAAATCAGTAGAGTGG + Intergenic
1199167107 X:144690071-144690093 ATGGAAACAAGCCAATAGAGAGG - Intergenic
1201223072 Y:11789925-11789947 ATATAAATAAGTCATTGGGCAGG - Intergenic