ID: 1039554220

View in Genome Browser
Species Human (GRCh38)
Location 8:38465588-38465610
Sequence AAACAAGTCATTAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 191}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039554208_1039554220 14 Left 1039554208 8:38465551-38465573 CCGGAGCTTCTCCTAACCCACTG 0: 1
1: 0
2: 3
3: 17
4: 165
Right 1039554220 8:38465588-38465610 AAACAAGTCATTAGGGAGGCAGG 0: 1
1: 0
2: 1
3: 22
4: 191
1039554216_1039554220 -3 Left 1039554216 8:38465568-38465590 CCACTGGGGGTAGGATATGTAAA 0: 1
1: 0
2: 0
3: 8
4: 76
Right 1039554220 8:38465588-38465610 AAACAAGTCATTAGGGAGGCAGG 0: 1
1: 0
2: 1
3: 22
4: 191
1039554214_1039554220 3 Left 1039554214 8:38465562-38465584 CCTAACCCACTGGGGGTAGGATA 0: 1
1: 0
2: 2
3: 5
4: 74
Right 1039554220 8:38465588-38465610 AAACAAGTCATTAGGGAGGCAGG 0: 1
1: 0
2: 1
3: 22
4: 191
1039554215_1039554220 -2 Left 1039554215 8:38465567-38465589 CCCACTGGGGGTAGGATATGTAA 0: 1
1: 0
2: 0
3: 6
4: 53
Right 1039554220 8:38465588-38465610 AAACAAGTCATTAGGGAGGCAGG 0: 1
1: 0
2: 1
3: 22
4: 191
1039554206_1039554220 16 Left 1039554206 8:38465549-38465571 CCCCGGAGCTTCTCCTAACCCAC 0: 1
1: 0
2: 1
3: 6
4: 92
Right 1039554220 8:38465588-38465610 AAACAAGTCATTAGGGAGGCAGG 0: 1
1: 0
2: 1
3: 22
4: 191
1039554207_1039554220 15 Left 1039554207 8:38465550-38465572 CCCGGAGCTTCTCCTAACCCACT 0: 1
1: 0
2: 1
3: 20
4: 177
Right 1039554220 8:38465588-38465610 AAACAAGTCATTAGGGAGGCAGG 0: 1
1: 0
2: 1
3: 22
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039554220 Original CRISPR AAACAAGTCATTAGGGAGGC AGG Intronic
901908767 1:12437342-12437364 AAACAACTGATTAGAAAGGCAGG + Intronic
902295766 1:15465962-15465984 AGAGAAGCCATTAGGGATGCAGG - Intronic
902298650 1:15485864-15485886 AGAGAAGCCATTAGGGACGCAGG - Intronic
902963122 1:19978604-19978626 AAAGAAGCCATTTGGGAGGAAGG - Intronic
903538289 1:24081959-24081981 AAACAAGTCATGACACAGGCTGG + Intronic
904932940 1:34104821-34104843 AACTAGGTCATTAGGGATGCTGG + Intronic
905112909 1:35610448-35610470 AAACAACTCATGAGGTAGGGAGG + Intronic
905682963 1:39887631-39887653 AAAGAAGGCAATAGGGAGTCAGG + Intergenic
906531150 1:46524804-46524826 AAAGATGGCATGAGGGAGGCAGG - Intergenic
907290518 1:53409560-53409582 AGACAAGTCACTAGGGAGAGGGG - Intergenic
908242460 1:62198829-62198851 AAAAAAGTGATTAGGGAGACCGG - Intronic
908267964 1:62397098-62397120 AGCCAAGTCAGGAGGGAGGCGGG + Intergenic
909110260 1:71466704-71466726 AACCAAGGCAGTAAGGAGGCTGG + Intronic
910968390 1:92830627-92830649 AAAGAAGTCATGAAGCAGGCTGG - Intergenic
916901203 1:169225686-169225708 AGACAATTCATTAGGGAGGGGGG - Intronic
916918031 1:169431156-169431178 ACACAAATCAGTAGTGAGGCAGG - Intronic
917376841 1:174357894-174357916 AAACATGTTATTAGGGTGCCTGG - Intronic
917637455 1:176950885-176950907 AAACCAGGCAGTAGGGAGGGAGG - Intronic
918940338 1:190987103-190987125 AAACAATTCTTTAGGGACTCTGG + Intergenic
920610550 1:207432670-207432692 AAACAAGTAAAGAGAGAGGCCGG + Intergenic
920820001 1:209371406-209371428 GAACAAGTCATCAGGGATCCAGG + Intergenic
922077996 1:222266878-222266900 AAATGAGTCAGCAGGGAGGCAGG - Intergenic
922580442 1:226693461-226693483 AAACATGTCAGTAGGGGGACAGG - Intronic
924147800 1:241095041-241095063 TAAAAAGTCATTAGATAGGCTGG + Intronic
924229441 1:241951228-241951250 AAAAAAGTCAGAAAGGAGGCCGG - Intergenic
1063076777 10:2724689-2724711 AAACATGTCAATAAGGTGGCTGG - Intergenic
1065817826 10:29498119-29498141 AAAAAAGTAATTATGGGGGCTGG + Intronic
1066195538 10:33095873-33095895 AAACAGGTGATTAGGGAGAGAGG + Intergenic
1067853490 10:49769964-49769986 AGAAAAGTCATTCTGGAGGCTGG + Intergenic
1071260585 10:83915673-83915695 CACCAAGTCATTCGGGAGGCTGG + Intergenic
1071733183 10:88269394-88269416 AAACATGAAATTAGGGAGGGAGG - Intergenic
1075079931 10:119376545-119376567 AAAAAAGGCATTAGGGAGTAGGG - Intronic
1079042139 11:17068661-17068683 GGAAAAGTCATAAGGGAGGCTGG - Intergenic
1080451895 11:32384746-32384768 AAACAGGGCATCAGGGAGGCAGG + Intergenic
1080518749 11:33048027-33048049 AAACATGACTTTAGAGAGGCTGG - Intronic
1083400817 11:62422319-62422341 GATCAAGACATGAGGGAGGCAGG + Exonic
1084135249 11:67173965-67173987 ATACCAGCAATTAGGGAGGCTGG - Intronic
1085927771 11:81041914-81041936 AAACATGACATCAAGGAGGCAGG - Intergenic
1086674256 11:89585688-89585710 AAACAAGGCATACGGGAGGATGG - Intergenic
1088181411 11:107116856-107116878 AGACAAGTCAGCAGTGAGGCTGG - Intergenic
1088514700 11:110618024-110618046 TAAGGAGTCATTAGGGAGGCTGG + Intronic
1090252040 11:125258352-125258374 AAACACGTCATTAGTGAAGCTGG + Intronic
1090358116 11:126154171-126154193 AAACAAGTCATTAGCTGGGTCGG - Intergenic
1092098139 12:5861290-5861312 TCACAAGAAATTAGGGAGGCAGG + Intronic
1095502110 12:42851244-42851266 AAAGCAGTCATTAGGGAGGCTGG + Intergenic
1096302076 12:50438499-50438521 AAAAAAGGGATTAAGGAGGCAGG + Intronic
1097736907 12:63192620-63192642 AAGCAAGTCAGGAAGGAGGCTGG + Intergenic
1097928418 12:65157173-65157195 AATTAAGTCTTTGGGGAGGCAGG + Intergenic
1098284387 12:68893157-68893179 AAAAAAGACAGTAGGGTGGCTGG + Intronic
1098771245 12:74556297-74556319 AAATGAGACATTAGGGAGGGTGG - Intergenic
1102478840 12:113206761-113206783 AAAAAAATCACTGGGGAGGCCGG + Intronic
1103857382 12:123982286-123982308 ACAGAAGTCATTAGAGAGGAAGG + Intronic
1105787015 13:23759690-23759712 AAACAAGGCACTGGAGAGGCTGG - Intronic
1106847847 13:33755946-33755968 AAACATGTGGTTAGGGAGGCAGG - Intergenic
1107569246 13:41639126-41639148 AAAAAAGTCATTATGGAGATTGG + Intronic
1108260787 13:48653720-48653742 AAACCAGTCATTAGAGGGGCAGG + Intronic
1109895055 13:68676282-68676304 AAACAAGTCAGGAGGGAGCTGGG + Intergenic
1111416770 13:87956833-87956855 AAACAGGAGATTAGGGAGGCAGG + Intergenic
1112850880 13:103705354-103705376 ATACAAATCTTCAGGGAGGCTGG + Intergenic
1113500471 13:110770086-110770108 AAAAAAGTGATTTGGTAGGCCGG - Intergenic
1113610541 13:111641928-111641950 AAAGAAAACACTAGGGAGGCTGG + Intronic
1114456381 14:22856915-22856937 AAACAAGTCACTGGCCAGGCAGG - Intergenic
1115267223 14:31512902-31512924 ACCCAAGTGATTATGGAGGCTGG - Intronic
1115532186 14:34337646-34337668 AAACAGGTGATGTGGGAGGCTGG - Intronic
1116055523 14:39859579-39859601 AAGCATGTTATTAGGGAAGCAGG + Intergenic
1117306069 14:54474349-54474371 AAACAAGTCATTTGGCAGCTTGG - Intergenic
1118143980 14:63116123-63116145 AAACAACTAAATAGGAAGGCGGG + Intergenic
1118281873 14:64436388-64436410 AAAAAAATGATTAGGTAGGCCGG - Intronic
1118520110 14:66573749-66573771 AAAAAAGTCATTATATAGGCTGG - Intronic
1119782926 14:77290047-77290069 AACTAAGTCAATAGGGAGGGAGG + Intronic
1121032938 14:90674903-90674925 TACCCAGTCATTTGGGAGGCAGG + Intronic
1122543158 14:102508997-102509019 AAAGAAGGCAGTAGGGAGGTTGG - Intronic
1125911002 15:43439034-43439056 AAATAATTCAGTAGGGAGGGGGG + Intronic
1126464543 15:48949380-48949402 AAAAAAAACCTTAGGGAGGCTGG + Intronic
1126775155 15:52094155-52094177 AAATAGGTCAGGAGGGAGGCTGG + Intergenic
1127418320 15:58779385-58779407 AAAAAAGTCATCAAGGAGGTAGG - Intronic
1127536589 15:59895450-59895472 AAATTAGTCATCAGGGATGCAGG + Intergenic
1129634389 15:77299375-77299397 AAACAAGTTATTAGGGATGATGG - Intronic
1131843761 15:96467472-96467494 TAAAACATCATTAGGGAGGCAGG + Intergenic
1133934441 16:10257198-10257220 CCACAATTCATTAGGGAGACAGG - Intergenic
1134103244 16:11467683-11467705 TAACAAGTTTTGAGGGAGGCAGG - Intronic
1135467968 16:22703500-22703522 AGACAAGTCCCTAGTGAGGCTGG - Intergenic
1137577635 16:49613394-49613416 AAACAATTCAATGGAGAGGCTGG + Intronic
1137949620 16:52771306-52771328 AGCCAAGTCATTAGGGAAGAAGG + Intergenic
1139184602 16:64791095-64791117 AAAGAAGACATAAAGGAGGCAGG + Intergenic
1144286493 17:13779696-13779718 AAAAAAATCATTAGGCAGTCTGG - Intergenic
1146409425 17:32569616-32569638 AGAAAAGGCATTATGGAGGCAGG - Intronic
1147326964 17:39674233-39674255 GAACAAGGCTTTAGGGACGCTGG + Intronic
1148105193 17:45115093-45115115 AAGAAACTCATTCGGGAGGCAGG - Exonic
1149905237 17:60520274-60520296 AAAAAAATCATTAAGGAGGCCGG + Intronic
1150535846 17:66039717-66039739 TAATAAGGCTTTAGGGAGGCTGG - Intronic
1153906508 18:9666348-9666370 ATACAGTTCATTAGGGAGGCAGG - Intergenic
1154208761 18:12361078-12361100 ATAAAACTCATTAGAGAGGCTGG + Intronic
1154373512 18:13788545-13788567 ATAGATGTCATTAGTGAGGCTGG + Intergenic
1155483375 18:26314025-26314047 AAACAACACATTAGGGATGAGGG - Intronic
1156039609 18:32805695-32805717 AAAAAAATCAGTGGGGAGGCAGG - Intergenic
1158528711 18:58238679-58238701 AAAGAAGTAATCAGAGAGGCAGG - Intronic
1159230464 18:65601032-65601054 AGACAATTAATGAGGGAGGCAGG + Intergenic
1160056894 18:75491756-75491778 ACAAAAGTCATTAAGTAGGCTGG + Intergenic
1168283485 19:55319089-55319111 AAAAAAGAAATTAGTGAGGCTGG - Intronic
925213387 2:2070893-2070915 AAATAGGTCATTAGGAATGCAGG - Intronic
927586046 2:24306274-24306296 TAAAAATTCATTAGGCAGGCCGG - Intronic
930793853 2:55366615-55366637 AAAAAAGTGATTAGGGTGGGAGG + Intronic
932568285 2:72923281-72923303 AAAAAAGACAGTAGGGAGGCTGG + Intronic
932800391 2:74737216-74737238 AAAAAAGTCAATAGGGAGGGTGG - Intergenic
933435038 2:82238405-82238427 AAACAAGTCATTAGGTGGCTGGG - Intergenic
933788709 2:85866155-85866177 AAACAAGACATTAGGTATACAGG - Intronic
934019058 2:87925280-87925302 AAACAAGTCATTGAGGAGCTTGG - Intergenic
934774904 2:96931081-96931103 AAACAAGTCATAAGATGGGCTGG + Intronic
935375874 2:102397017-102397039 AAACTTGTCATTAGGTTGGCGGG + Exonic
938167565 2:129044252-129044274 AAACTAATCATTAGGGATGTAGG - Intergenic
944042200 2:195368392-195368414 AAACAAGTAACTAGGAAGGAAGG + Intergenic
944723719 2:202448750-202448772 AAATCAGTCATTAAAGAGGCCGG - Intronic
946486165 2:220102871-220102893 AAAGCTGCCATTAGGGAGGCCGG - Intergenic
946518817 2:220443709-220443731 AAACAAGTCCTTTGGAAGGACGG - Intergenic
1169147384 20:3261799-3261821 AAACAAGTCATTTTGGAGACTGG + Intronic
1172081809 20:32347448-32347470 ATACAATTGATTTGGGAGGCAGG - Intergenic
1172560216 20:35881352-35881374 TAAAAAGTACTTAGGGAGGCCGG - Intronic
1172962409 20:38807799-38807821 AAAGAAGACATTACAGAGGCTGG - Intronic
1173077389 20:39832579-39832601 CAATAATTCATTAGGGAGGAGGG - Intergenic
1173942398 20:46922589-46922611 AAATAAGTAAATAGGGAGGAGGG + Intronic
1174694207 20:52541136-52541158 CAAAATGTCATGAGGGAGGCAGG - Intergenic
1176902875 21:14464756-14464778 AAATAAGTCATTAGGTAGAAGGG + Intergenic
1179507827 21:41853377-41853399 AATCAGGTCATTTGGGAGGGGGG + Intronic
1181963920 22:26643247-26643269 ACACAAAACATCAGGGAGGCAGG + Intergenic
1182233240 22:28855006-28855028 AAAGAAGTAATTAAGGTGGCCGG - Intergenic
1182889108 22:33801809-33801831 AAACTAGTCACTGGGGAAGCGGG - Intronic
1183886621 22:40888993-40889015 AAAAAAACCATTAGGAAGGCAGG - Intronic
1184000794 22:41671923-41671945 AAAAAAGTCATTACGTTGGCTGG + Intergenic
949116168 3:327134-327156 AAATAAGTCAGGAGGGTGGCTGG + Intronic
950322347 3:12068728-12068750 AGAGAACTCATTAGGAAGGCTGG - Intronic
951847973 3:27104898-27104920 AAACAAGAAATTGGGGAAGCTGG + Intergenic
956379064 3:68646887-68646909 ATGGAAGTTATTAGGGAGGCTGG - Intergenic
956605904 3:71072739-71072761 AAGCAAGTGGTTTGGGAGGCTGG - Intronic
956880116 3:73501717-73501739 AAACAAGTCATTAGAAGGCCAGG + Intronic
959659268 3:108847665-108847687 ACACAAGTGATAAGGGATGCTGG - Intronic
959933807 3:112009795-112009817 AAAGAAGCCACTAGGGAAGCGGG - Intronic
960151855 3:114257480-114257502 AAAGAAAACATTGGGGAGGCCGG - Intergenic
960220324 3:115100250-115100272 AATGGACTCATTAGGGAGGCAGG - Intronic
961014687 3:123458544-123458566 CAAGAAGTCTTTGGGGAGGCTGG + Intergenic
962129100 3:132653469-132653491 AAAGAAGTCCTTAAGAAGGCAGG - Intronic
964172733 3:153790127-153790149 AAACATGTCAGTAGAGTGGCAGG - Intergenic
966624379 3:182000613-182000635 AACCAATTCTTTAGGAAGGCTGG + Intergenic
967207365 3:187136337-187136359 AAAGATGTCATCAGGGAGGGTGG - Intronic
971320378 4:25600684-25600706 AAACAAGCTAATAGAGAGGCTGG + Intergenic
972705505 4:41538858-41538880 AAGGAAGACATTGGGGAGGCAGG + Intronic
973556262 4:52086248-52086270 AAAAAAGTCAGTAAGGAAGCTGG - Intronic
973756432 4:54078809-54078831 TAACAAATCATAAGAGAGGCCGG - Intronic
975153142 4:71042788-71042810 AAAAAATTCAGTAAGGAGGCCGG - Intergenic
975853782 4:78601080-78601102 AAATAACTCATTAGGCACGCAGG - Intronic
975973053 4:80065458-80065480 AAGCAAGTCTTTAGGTAGGTGGG + Intronic
977201154 4:94118527-94118549 AAACTAGTGATTAGGCAGGCTGG + Intergenic
977759020 4:100708374-100708396 AACCAAGACATCAGGGTGGCAGG + Intronic
977813383 4:101384845-101384867 AAAGAAGTCATTATATAGGCCGG - Intergenic
979563015 4:122121331-122121353 TAAAAAGTTATTGGGGAGGCCGG + Intergenic
979762372 4:124422232-124422254 AAACAGACTATTAGGGAGGCAGG - Intergenic
980480031 4:133376520-133376542 AAACATTTCATTTGGGAAGCAGG + Intergenic
980559539 4:134454874-134454896 AAACAAATCATAAGAGAGGAAGG + Intergenic
982068302 4:151673448-151673470 AAAGATGACTTTAGGGAGGCAGG + Intronic
982995077 4:162333593-162333615 ATTCAAGTGATTTGGGAGGCTGG - Intergenic
984269071 4:177528733-177528755 AGGCAAGTCATAAGGGAGGAGGG + Intergenic
987456133 5:18149368-18149390 AAACTAGTCTTTAGGGAGCCAGG + Intergenic
987898711 5:23982576-23982598 AATCAGGTGATTATGGAGGCTGG - Intronic
988002219 5:25363125-25363147 ACACAAGTCACTAGGGAAGTGGG - Intergenic
989047336 5:37285702-37285724 AATCCAGTCACTTGGGAGGCTGG - Intergenic
990364466 5:55055743-55055765 AAGAAAATCATAAGGGAGGCTGG + Intergenic
992638329 5:78747020-78747042 AAACAAGTCGTTAAGGAGCCAGG + Intronic
993462771 5:88204683-88204705 AAAGAAGCCATTAGGGAGACGGG + Intronic
995351007 5:111175625-111175647 AAACAGGTCACTTAGGAGGCTGG - Intergenic
996010219 5:118474080-118474102 AAACAATTCATTAGAAAGCCAGG - Intergenic
1006742505 6:36319627-36319649 AAACAGGTCATTAGTGTTGCTGG + Intronic
1007966780 6:46010617-46010639 ACACAAGTCATCAGGGATGCAGG + Intronic
1008018443 6:46547904-46547926 AAGCAAGAAATTAGGGAGGAAGG - Intergenic
1008525055 6:52399242-52399264 CATAAAGTCATGAGGGAGGCTGG + Intronic
1008812064 6:55514832-55514854 AAACAAGTCACTGGAGAGCCTGG - Intronic
1009924394 6:70102407-70102429 AACCAAGAGATGAGGGAGGCTGG + Intronic
1010586743 6:77664334-77664356 AAACAAGTCATGAAGTGGGCTGG + Intergenic
1015478574 6:133681403-133681425 AGACAAGTCATCAACGAGGCTGG - Intergenic
1015737186 6:136413595-136413617 AAAAAAGACATTTGGGATGCAGG - Intronic
1016472163 6:144386163-144386185 AAAAAATTCATTAGTAAGGCTGG + Intronic
1017904048 6:158743885-158743907 CAACAAGTCATCAGACAGGCTGG - Intronic
1019761396 7:2815404-2815426 AAAGAAAACATGAGGGAGGCTGG + Intronic
1020427311 7:8083234-8083256 ATACAAGTAAGTAGGGAGGATGG - Intronic
1021040322 7:15854026-15854048 AAATAAGTCATCAGGGATTCTGG - Intergenic
1025042921 7:55663400-55663422 AAAAAATTCTTAAGGGAGGCTGG + Intergenic
1028916061 7:96260572-96260594 AAACATGCAATTAGAGAGGCAGG - Intronic
1029509863 7:100987361-100987383 AAAAAAATCATTAGCTAGGCTGG - Intronic
1031206467 7:118764436-118764458 GAACAAGTCATTCTGCAGGCTGG + Intergenic
1031525547 7:122818852-122818874 AAACAAGTCATGAGCTGGGCTGG - Intronic
1035426612 7:158780700-158780722 AAACTAATCGTCAGGGAGGCAGG + Intronic
1039049434 8:33479458-33479480 AAACAAGTAAAGAGGGAGCCTGG + Intronic
1039110018 8:34031669-34031691 ACACAAGTCATGATGGTGGCTGG + Intergenic
1039554220 8:38465588-38465610 AAACAAGTCATTAGGGAGGCAGG + Intronic
1041111262 8:54484982-54485004 AAACATGTCTTTGGGGAAGCTGG + Intergenic
1046707776 8:117475620-117475642 AAACAAGACATGAAAGAGGCAGG - Intergenic
1047471534 8:125178572-125178594 AAAGAAGTCATTAGGTTGGCTGG + Intronic
1048353362 8:133633801-133633823 AAAAAACTCATTTGGGGGGCTGG - Intergenic
1048779344 8:137984577-137984599 AAGCAAGTCATTCAGGAAGCAGG - Intergenic
1049906501 9:222104-222126 AAACAAAACATTAGGCAGACAGG + Intronic
1050450527 9:5776439-5776461 AAACAAGTCATTGGGGGTGTGGG + Exonic
1050737150 9:8776686-8776708 AAACAGGACATTTGAGAGGCAGG + Intronic
1052257748 9:26478991-26479013 AAGGAGGTGATTAGGGAGGCAGG + Intergenic
1052801057 9:32968655-32968677 AAGCAAGTGATTAGGGAAACTGG - Intergenic
1055740150 9:79379427-79379449 AAACAAGTCTTTAGAGTGCCAGG - Intergenic
1058218389 9:102263633-102263655 AAACAATTCAAAAGGGAGGCTGG + Intergenic
1059307829 9:113368493-113368515 AAACAAGTCATGCTGGATGCAGG + Intronic
1185942405 X:4336349-4336371 AAACAAGGCATGCGAGAGGCAGG - Intergenic
1187415071 X:19086392-19086414 AACCATGACATCAGGGAGGCTGG + Intronic
1194739120 X:97551109-97551131 TAAAAAGCCATTAAGGAGGCAGG + Intronic
1195121199 X:101754809-101754831 AATCTAATCATTCGGGAGGCTGG - Intergenic
1196816009 X:119666092-119666114 AAAAGAGTCAGTAGAGAGGCAGG + Intronic
1198372446 X:136004066-136004088 AAAAAAAAGATTAGGGAGGCAGG - Intronic
1199125469 X:144113859-144113881 AAACAAGTCATTGAGGAGCTTGG + Intergenic
1201223071 Y:11789921-11789943 AAATAAGTCATTGGGCAGGATGG - Intergenic
1201940703 Y:19456252-19456274 AAAAAAGTCAATAGGTAGGTAGG + Intergenic