ID: 1039554221

View in Genome Browser
Species Human (GRCh38)
Location 8:38465595-38465617
Sequence TCATTAGGGAGGCAGGCCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 103}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039554216_1039554221 4 Left 1039554216 8:38465568-38465590 CCACTGGGGGTAGGATATGTAAA 0: 1
1: 0
2: 0
3: 8
4: 76
Right 1039554221 8:38465595-38465617 TCATTAGGGAGGCAGGCCATCGG 0: 1
1: 0
2: 1
3: 8
4: 103
1039554214_1039554221 10 Left 1039554214 8:38465562-38465584 CCTAACCCACTGGGGGTAGGATA 0: 1
1: 0
2: 2
3: 5
4: 74
Right 1039554221 8:38465595-38465617 TCATTAGGGAGGCAGGCCATCGG 0: 1
1: 0
2: 1
3: 8
4: 103
1039554215_1039554221 5 Left 1039554215 8:38465567-38465589 CCCACTGGGGGTAGGATATGTAA 0: 1
1: 0
2: 0
3: 6
4: 53
Right 1039554221 8:38465595-38465617 TCATTAGGGAGGCAGGCCATCGG 0: 1
1: 0
2: 1
3: 8
4: 103
1039554206_1039554221 23 Left 1039554206 8:38465549-38465571 CCCCGGAGCTTCTCCTAACCCAC 0: 1
1: 0
2: 1
3: 6
4: 92
Right 1039554221 8:38465595-38465617 TCATTAGGGAGGCAGGCCATCGG 0: 1
1: 0
2: 1
3: 8
4: 103
1039554208_1039554221 21 Left 1039554208 8:38465551-38465573 CCGGAGCTTCTCCTAACCCACTG 0: 1
1: 0
2: 3
3: 17
4: 165
Right 1039554221 8:38465595-38465617 TCATTAGGGAGGCAGGCCATCGG 0: 1
1: 0
2: 1
3: 8
4: 103
1039554207_1039554221 22 Left 1039554207 8:38465550-38465572 CCCGGAGCTTCTCCTAACCCACT 0: 1
1: 0
2: 1
3: 20
4: 177
Right 1039554221 8:38465595-38465617 TCATTAGGGAGGCAGGCCATCGG 0: 1
1: 0
2: 1
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039554221 Original CRISPR TCATTAGGGAGGCAGGCCAT CGG Intronic
903613885 1:24637916-24637938 TCATCAGGTAGGCAGCTCATCGG + Intronic
905979266 1:42209549-42209571 CCACTAGGGAGTCAGGCCAGTGG + Intronic
911651880 1:100398303-100398325 TCATCAGGGAGGTAGCCCAAAGG - Intronic
914920862 1:151846716-151846738 TCATTAGGCAGGCAGGGGAGAGG - Intergenic
917632277 1:176902260-176902282 TCATGAGGCAGGCAGGAAATTGG - Intronic
917724609 1:177816708-177816730 GGATGAGGGAGGCTGGCCATAGG - Intergenic
918053028 1:180991123-180991145 TCAGTATGGAGGAAGGTCATGGG - Intronic
918139295 1:181707065-181707087 TAGTCAGGGAGACAGGCCATGGG + Intronic
918297033 1:183166803-183166825 TCATTATGGGGGCAGGGCAGGGG - Intergenic
918446018 1:184617587-184617609 TCACCAGGGAGGCTGCCCATGGG + Intronic
918459954 1:184766178-184766200 TTATTTGTGAGGCAGGGCATTGG - Intergenic
920634528 1:207686797-207686819 ACATTAGGGAGTGAGGCCTTTGG + Intronic
1063320746 10:5050844-5050866 TCATAAGGTAGGCAGGCACTAGG + Intronic
1064583236 10:16815008-16815030 GCTGTAGGGAGGAAGGCCATGGG + Intronic
1065999887 10:31094698-31094720 TGATTAGTGATGCCGGCCATGGG - Intergenic
1070602953 10:77878437-77878459 TCCTAAGGAAGGCAGGGCATGGG + Intronic
1077439978 11:2563570-2563592 TCATTAGGCAGACAGACCCTGGG - Intronic
1077602196 11:3581460-3581482 TCCTTGGGGAGGGAGACCATCGG - Intergenic
1078106735 11:8362637-8362659 CCATTAGGGAGGCACGTCACTGG + Intergenic
1079689577 11:23404227-23404249 CCTTTTGGGAGGCCGGCCATGGG - Intergenic
1080464893 11:32487419-32487441 TCTTTGGGGAGGCTGGCCTTAGG + Intergenic
1081362338 11:42195941-42195963 TTATTAGGGGGTCAGACCATAGG + Intergenic
1082103762 11:48197621-48197643 TCATTAAGGAGACAGTCCCTTGG + Intergenic
1083263793 11:61536930-61536952 TCATGAGGGAAACAGGCCTTTGG - Intronic
1086844808 11:91735456-91735478 TCTTTAGGGTTTCAGGCCATAGG - Intergenic
1090852148 11:130580036-130580058 TGATTAGTGAGGCAGGCCTTGGG - Intergenic
1102210071 12:111120124-111120146 TCATGATGGAGCAAGGCCATGGG - Intronic
1107653490 13:42568590-42568612 TTATTAGGGAGGCCGGTCCTAGG + Intronic
1108524672 13:51276629-51276651 TCACTAAGGATGCTGGCCATGGG - Intronic
1108750006 13:53439294-53439316 TCATTAAGGAGCCAGGGCAAAGG + Intergenic
1109854664 13:68111294-68111316 TCATTTGGGAGCTAGGCCCTAGG - Intergenic
1118346950 14:64947697-64947719 TCACTGGGGAGGCAGGCCCATGG + Exonic
1119406455 14:74402482-74402504 TCCTAAGGGTGGCAGGCCAGGGG - Intergenic
1121028164 14:90632090-90632112 CCAGTAGGGAGGGAGGCCTTTGG - Intronic
1122773186 14:104106184-104106206 GCTGTAGGGAGGCAGGCCAGAGG + Intronic
1127536590 15:59895457-59895479 TCATCAGGGATGCAGGTCTTTGG + Intergenic
1130878969 15:88038607-88038629 TCATGAGGGAGGCTGTGCATGGG + Intronic
1132927012 16:2435982-2436004 GGAATGGGGAGGCAGGCCATCGG - Intronic
1133934440 16:10257191-10257213 TCATTAGGGAGACAGGACAAAGG - Intergenic
1135526837 16:23219698-23219720 TCATCAGGGAGGTGGTCCATGGG - Intergenic
1140065977 16:71611394-71611416 TTATGAGGGAGGCAGTCCTTAGG - Intergenic
1146828114 17:36041600-36041622 TCATTAGACATGCAGGACATAGG - Intergenic
1147155503 17:38542661-38542683 CCAGTAGGGAGGCAGGGCCTTGG + Intronic
1147187495 17:38720549-38720571 ACCTTGGGGAGGCAGGCCATAGG - Exonic
1153376685 18:4388448-4388470 TCATTAGTGAAGAAAGCCATTGG + Intronic
1156490434 18:37492795-37492817 TCATCCTTGAGGCAGGCCATGGG - Intronic
1157146217 18:45165377-45165399 TCATAAGGGATGCTGGCAATTGG - Intergenic
1164107934 19:22125339-22125361 TCATTGGGGAGGGATGCCAGAGG + Intergenic
1164909228 19:31992225-31992247 ACTTTAGGGAGGCAGGCGATGGG - Intergenic
1167942522 19:52959060-52959082 TTCTTAGAGAGGCAGGCCACTGG - Intronic
926538658 2:14146662-14146684 TCTTTAGGGAGGCAGGGAAGAGG + Intergenic
926945540 2:18183675-18183697 TAATGAGGAAGGCAGGCCAGAGG + Intronic
932319621 2:70812192-70812214 TCAGCAGGGAGGAAGGCCAAGGG - Intronic
935287096 2:101574689-101574711 TCATTTGGGAGGCAGGCCCCAGG - Intergenic
938063926 2:128271034-128271056 TCATGATGGAGGCATGCCTTGGG - Intronic
938092002 2:128440449-128440471 GCTTCAGGGAGGCAGGGCATAGG + Intergenic
942325161 2:174770108-174770130 GCACTATGGAGGCAGGCCACTGG + Intergenic
942492236 2:176501034-176501056 TTATTAGGAAGGCAGGCCATGGG - Intergenic
1170483778 20:16794505-16794527 TCCTTAGGGAGGGTGGCCAGAGG - Intergenic
1174681920 20:52416704-52416726 TCCTGAGGGAGGGAGGCCAGAGG + Intergenic
1175029689 20:55939639-55939661 TGACTCTGGAGGCAGGCCATGGG + Intergenic
1178102949 21:29289962-29289984 TTATTAGGGGGTCAGGCCTTTGG - Intronic
1178583448 21:33854644-33854666 TCAGGAAGGAGGCAGGCCACGGG - Intronic
1181963921 22:26643254-26643276 ACATCAGGGAGGCAGGCCTGTGG + Intergenic
1183404548 22:37623986-37624008 TCATTAGGGAGGAAGGTCTGGGG - Intronic
1185088250 22:48752317-48752339 TCAGTAGGGAGGCTGGCCCCAGG + Intronic
949985360 3:9536553-9536575 TAATCAGGGAGGAAGGTCATGGG - Intronic
950508915 3:13414077-13414099 ACAGGAGGCAGGCAGGCCATAGG + Intronic
955687672 3:61562540-61562562 TGTTTAGGGAGGCAGGCTAGTGG + Intronic
960590502 3:119361256-119361278 TCAGTAGGGAGGCAGGTGGTAGG - Intronic
961601267 3:128063989-128064011 TCCTGAGGGAGGCAGGCCTAGGG - Intronic
962286219 3:134087464-134087486 ACATTAGAGCGGCAGGCCCTTGG - Intronic
962607585 3:137045330-137045352 TCATTGGGGAGGGTGGTCATGGG - Intergenic
964544348 3:157817144-157817166 GCATTAGGAAGGCAGGTTATGGG - Intergenic
965877615 3:173346715-173346737 TCCTGAGGGAGTCAGGCCCTAGG - Intergenic
972283141 4:37622579-37622601 TCATTACGGAGCCAGGACCTGGG - Intronic
976246341 4:83010142-83010164 TCTTTAGGGAGGCAGAGCATTGG - Intronic
976353612 4:84088495-84088517 TCAGTAAGGAGGGAGGGCATAGG - Intergenic
976860187 4:89655869-89655891 TCATAAGGGTGGCATGCAATAGG - Intergenic
979957260 4:126969286-126969308 TTATTAGGGAGGCAGGCACATGG - Intergenic
985624765 5:979593-979615 TCATTACGAAGTCAGGCCAGAGG - Intronic
990271266 5:54142571-54142593 TCATTGGAGAGGGAGGCCACAGG - Intronic
999571248 5:152922261-152922283 TCAGTAGGGAGGCAGAGCATTGG + Intergenic
1000740302 5:164960702-164960724 GAATCAGTGAGGCAGGCCATAGG - Intergenic
1002096024 5:176831494-176831516 TCCTTAGGAAGGCAAGCCTTGGG + Intronic
1007620734 6:43212965-43212987 TCATCAGGGAGGCAGGCGCAGGG + Intronic
1007714964 6:43850578-43850600 TCATTTGGGAGGCAGGGTGTGGG + Intergenic
1017806266 6:157948165-157948187 ACACTTGGGAGGCAGGCCTTGGG - Intergenic
1019205527 6:170358644-170358666 CCATCTGGGAGGCAGGCCAAGGG - Intronic
1019515569 7:1438455-1438477 GCATTAGGGAGGCAGGGCTGGGG - Intronic
1021113515 7:16723140-16723162 TCATCTGGGAGGCAGGCTGTTGG - Intergenic
1021585643 7:22204661-22204683 TTTTTAGGGAGGCACGCCTTTGG + Intronic
1022274549 7:28842446-28842468 TCATTAGGGAGGAAGTTCTTTGG - Intergenic
1024412038 7:49054824-49054846 ACATTAGGGAGCCAGGACAGGGG - Intergenic
1030088576 7:105837869-105837891 TCACGAGGGAGGCAGGCATTTGG - Intronic
1034117663 7:148598479-148598501 TGATTAAGGAAGCAGGGCATTGG - Intronic
1036391136 8:8325222-8325244 TCATTGGGGGGGCGGGCCGTGGG - Intronic
1037386846 8:18352133-18352155 ACCTTAGGGAGCCAGGTCATGGG + Intergenic
1039554221 8:38465595-38465617 TCATTAGGGAGGCAGGCCATCGG + Intronic
1040066313 8:43147439-43147461 TCATCAGGGAGGCAGGGCCCTGG - Intronic
1040833728 8:51708931-51708953 TAATTAGGGAGGGGGGCAATAGG + Intronic
1046550460 8:115709385-115709407 TCTTTAGGGAGGAAGACCAGAGG - Intronic
1046990354 8:120445526-120445548 CCAGTAGGGAGGCAGAACATGGG + Exonic
1047529770 8:125664359-125664381 TCATAAGGGAGGGAGGCCTGGGG - Intergenic
1052219123 9:25998223-25998245 TAATTAGGGTGGCAGGGCCTTGG - Intergenic
1052997690 9:34559859-34559881 TCAGTGGGGAGGCTGGCCAGGGG - Intronic
1053293368 9:36896738-36896760 CCATGAGGGAGGCAGGGCAGGGG - Intronic
1060530823 9:124346279-124346301 TCCTGAAGGAGGCAGGCCCTTGG + Intronic
1188117753 X:26265799-26265821 TCATTAGGCATGTAAGCCATAGG - Intergenic
1190594609 X:52040709-52040731 GCATCAGGGAGGCAGGAGATGGG + Intergenic
1190798678 X:53769125-53769147 TCATGAGGGAGTCAGGCCCTTGG + Intergenic
1196685605 X:118507813-118507835 TTTTCAGTGAGGCAGGCCATAGG + Intronic
1200958450 Y:8973598-8973620 TCAGTCAGGAGGCAGGGCATGGG - Intergenic