ID: 1039554222

View in Genome Browser
Species Human (GRCh38)
Location 8:38465604-38465626
Sequence AGGCAGGCCATCGGCAAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039554208_1039554222 30 Left 1039554208 8:38465551-38465573 CCGGAGCTTCTCCTAACCCACTG 0: 1
1: 0
2: 3
3: 17
4: 165
Right 1039554222 8:38465604-38465626 AGGCAGGCCATCGGCAAAGACGG 0: 1
1: 0
2: 2
3: 8
4: 171
1039554215_1039554222 14 Left 1039554215 8:38465567-38465589 CCCACTGGGGGTAGGATATGTAA 0: 1
1: 0
2: 0
3: 6
4: 53
Right 1039554222 8:38465604-38465626 AGGCAGGCCATCGGCAAAGACGG 0: 1
1: 0
2: 2
3: 8
4: 171
1039554214_1039554222 19 Left 1039554214 8:38465562-38465584 CCTAACCCACTGGGGGTAGGATA 0: 1
1: 0
2: 2
3: 5
4: 74
Right 1039554222 8:38465604-38465626 AGGCAGGCCATCGGCAAAGACGG 0: 1
1: 0
2: 2
3: 8
4: 171
1039554216_1039554222 13 Left 1039554216 8:38465568-38465590 CCACTGGGGGTAGGATATGTAAA 0: 1
1: 0
2: 0
3: 8
4: 76
Right 1039554222 8:38465604-38465626 AGGCAGGCCATCGGCAAAGACGG 0: 1
1: 0
2: 2
3: 8
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039554222 Original CRISPR AGGCAGGCCATCGGCAAAGA CGG Intronic
903195691 1:21686114-21686136 AAGCATGTCATCTGCAAAGAGGG + Intronic
903269233 1:22177410-22177432 AGGCAGGCTCTTGGGAAAGAGGG + Intergenic
903351332 1:22718313-22718335 TGGCAGGCACTGGGCAAAGAAGG - Intronic
903805263 1:26000787-26000809 AGGCAGGCAATGGGGAAATAAGG + Intergenic
904345334 1:29864575-29864597 AGGCTGGCCCTCGTCCAAGATGG - Intergenic
904376525 1:30085584-30085606 AGGCAGGGCACTGGCAGAGAGGG + Intergenic
904454455 1:30638932-30638954 AGGCCTGCCATGGGCAGAGAGGG + Intergenic
907087249 1:51686900-51686922 AAGCAGGACTTCTGCAAAGAAGG - Intronic
910067566 1:83171633-83171655 AATCATGCCATCTGCAAAGAGGG - Intergenic
913113080 1:115673270-115673292 AGGCAGGTAAGCGGCAAAGCTGG - Intronic
915541092 1:156566686-156566708 AGCCAGGCAATGGGCAGAGAAGG - Intronic
915921430 1:159978489-159978511 AGACAGGCCAGCAGCTAAGAAGG + Intergenic
917267017 1:173231675-173231697 AATCATGTCATCGGCAAAGAGGG - Intergenic
917568000 1:176231827-176231849 AGGCAGGCCATAGGCAGCCATGG - Intergenic
918169988 1:181987316-181987338 AGCAAGGCCATCTGCTAAGATGG - Intergenic
920385809 1:205569455-205569477 AGGCAGCTCTTCGGCCAAGATGG - Intronic
921478523 1:215637146-215637168 AGGCAGGCCATCAACAGAGACGG - Intronic
921736329 1:218633130-218633152 AGGCAGGATAGCAGCAAAGATGG + Intergenic
922619260 1:226980307-226980329 AGGTAGCCCATTGGCAAAGCTGG - Intronic
923211889 1:231810988-231811010 AGCCAGGCCATAGCAAAAGATGG - Intronic
923282925 1:232461978-232462000 AGGCAGCCCATAAGCACAGAGGG - Intronic
924537363 1:244947599-244947621 AAGCATGTCATCTGCAAAGAGGG - Intergenic
1063745714 10:8878213-8878235 GAGCAGGCCATCTGGAAAGACGG + Intergenic
1065186376 10:23173956-23173978 AGCCAGGCCAGCGGGAAAGAAGG + Intergenic
1065684591 10:28271170-28271192 AGGCAGCACATCTGCAAAGATGG - Intronic
1066646933 10:37619589-37619611 AGGCATGCCATCATCTAAGAGGG + Intergenic
1067686159 10:48466924-48466946 AAGCAGGTCCTGGGCAAAGAGGG - Intronic
1070454850 10:76602794-76602816 AGTCATGTCATCTGCAAAGAGGG + Intergenic
1070565521 10:77601181-77601203 AGGCAGGGTCTCGGCAGAGAAGG + Intronic
1072260334 10:93664133-93664155 AGGCAGGCCCTGGGGAAAGATGG + Intronic
1073085044 10:100882961-100882983 AGGCAGCCCATCGGGAATTAGGG + Intergenic
1074577707 10:114686062-114686084 AGGCAGGACAGGGGCAAAGTGGG + Intergenic
1074713807 10:116199977-116199999 AGGCAGTCCTTCGCAAAAGAGGG - Intronic
1075739513 10:124685775-124685797 AGGCTGGCCATGGGAAAGGAAGG - Intronic
1075900778 10:126041284-126041306 AGGCAGGCCATGAGCAAGCATGG - Intronic
1076158820 10:128225499-128225521 AGTCATGTCATCTGCAAAGAGGG + Intergenic
1079130306 11:17743470-17743492 GGCCAGGCCATGGGCTAAGAGGG + Intronic
1081221480 11:40469074-40469096 AGGGAGGCCATAGGGCAAGATGG + Intronic
1082991772 11:59212787-59212809 AGGCAAGCCTTCGGGAGAGATGG - Exonic
1083334086 11:61912823-61912845 AGGCAGGACCTGGGCTAAGAGGG + Intronic
1084181689 11:67450102-67450124 AGGAAGGGCAAAGGCAAAGACGG - Intergenic
1086464469 11:87038501-87038523 AGGCAGGCCAGAGGAAAATAAGG - Intronic
1087114739 11:94512860-94512882 AGGCAGGCTATCGGGAAGGAGGG - Intergenic
1088226594 11:107627006-107627028 AGGCAGGTCATGGTCAGAGATGG - Intronic
1094776300 12:33731962-33731984 AGGCTGGACAGCAGCAAAGATGG + Intergenic
1096649070 12:53053111-53053133 AGGCAGGCCATGGCCAGGGATGG - Intronic
1099142159 12:78992108-78992130 ATGCAGGGCATAGGTAAAGAAGG - Intronic
1101213940 12:102562366-102562388 AGGCAGACCAAGAGCAAAGAGGG - Intergenic
1102921882 12:116797588-116797610 AGGCAGGCAAGCCCCAAAGAGGG + Intronic
1103019179 12:117520111-117520133 AAGGCGGCCATTGGCAAAGAAGG + Intronic
1103426978 12:120844507-120844529 GGGCAGGCAGTCGGGAAAGAAGG - Intronic
1104086665 12:125481318-125481340 AGTCATGCCATCTGCAAATAGGG - Intronic
1105699149 13:22922884-22922906 AGCCAGGCCATCTCCAAGGAGGG + Intergenic
1105850893 13:24335733-24335755 AGCCAGGCCATCTCCAAGGAGGG + Intergenic
1110349783 13:74493830-74493852 AGTCATGTCATCTGCAAAGAGGG - Intergenic
1113180310 13:107617685-107617707 AGGCAGGACAAGTGCAAAGAAGG + Intronic
1117687010 14:58263731-58263753 AGCCAGGCAAGCTGCAAAGACGG + Exonic
1120394307 14:83948806-83948828 GGGCATGTCATCTGCAAAGAGGG + Intergenic
1121350669 14:93170370-93170392 TGGCAGGCCCTGGGCAATGAGGG - Intergenic
1121733288 14:96201358-96201380 AGGGAGGCCAGAGGCAGAGAAGG + Intergenic
1124017103 15:25886673-25886695 AAGGAGGCCATGGGGAAAGACGG + Intergenic
1131555191 15:93391904-93391926 AATCATGCCATCTGCAAAGAGGG + Intergenic
1134589888 16:15443967-15443989 CTGCAGGCCAACAGCAAAGAGGG + Intronic
1139462560 16:67134169-67134191 AGCCAGGCCATGGGCAAAATTGG - Exonic
1142673194 17:1496958-1496980 TGGCTGGCCATCAGGAAAGAGGG + Intronic
1143520570 17:7441996-7442018 TGACAGGCCATCAGCAAAGCTGG - Intronic
1144206012 17:12979979-12980001 AGGGTGGCCATCGGCAAGGCTGG + Intronic
1146145119 17:30408736-30408758 AGTCATGCCATCTGCAAACAGGG + Intronic
1147190335 17:38734717-38734739 AGGCAGGACAGCAGCCAAGATGG + Exonic
1147444918 17:40469194-40469216 AGGAGGGCCATCCGAAAAGAAGG - Intergenic
1147544864 17:41393528-41393550 AGGCAGGCCAGTGGGAAGGAGGG - Intronic
1150478200 17:65489658-65489680 AGCCAGGCCATCTGCAGAGCTGG + Intergenic
1155868381 18:30995114-30995136 AGACAGGCCAGTGGCAGAGAGGG - Intronic
1155972076 18:32092366-32092388 AGGGAGGCCTTGGGCGAAGACGG + Intronic
1156356541 18:36346835-36346857 AGGCAGGCCACCGGCCATGGAGG - Intronic
1156993716 18:43440545-43440567 AGGAAGGCTCTCAGCAAAGAGGG - Intergenic
1162936549 19:13984270-13984292 AGGCAGGCAAGGAGCAAAGAGGG - Intronic
927812123 2:26186059-26186081 AGGCAGCCTATTGGCAAAGTGGG + Intronic
929744521 2:44642241-44642263 AGGCAGGCCTGGGGCATAGATGG + Intronic
931549978 2:63432634-63432656 AGGCAGGCCAAGGGCAATCAGGG + Intronic
933103301 2:78287674-78287696 AGGCAAGCTCTCAGCAAAGAGGG - Intergenic
933809800 2:86026160-86026182 AGGCAGGCCAGGGGCAGAGGTGG + Exonic
933834260 2:86232672-86232694 GGGCGGGCCAGCGGCAAACACGG - Exonic
933874375 2:86603902-86603924 AAGAAGGCCACCGGCAAACAGGG + Exonic
938199628 2:129362269-129362291 AGGCAGGCCAGCGGCAGAGACGG - Intergenic
940826896 2:158422796-158422818 AGGCATGTCATCTGCAAACAGGG - Intronic
941767610 2:169315448-169315470 AGGTAGGCCAAAAGCAAAGAAGG + Intronic
944483291 2:200178746-200178768 AGGCAAGGCCTAGGCAAAGAAGG - Intergenic
944946293 2:204690054-204690076 ATGCAGGCTATAGGCAAACAGGG - Intronic
946025821 2:216671119-216671141 AATCAGGCCATCGGCAAGGCAGG + Intergenic
948777377 2:240296766-240296788 AGGCAGGGCCTGGGCAGAGACGG - Intergenic
949042105 2:241854223-241854245 CGGGAGGCCATGGGCACAGAGGG - Intronic
1168933440 20:1643910-1643932 AGGCTGGAGAACGGCAAAGATGG + Intronic
1169342578 20:4807719-4807741 AGTCAGGCCATAGACAAAGATGG - Intronic
1170041939 20:12048403-12048425 AGGTAAGTCATTGGCAAAGAGGG + Intergenic
1173185688 20:40838251-40838273 AGGCAGGCAATGAGCAAACAAGG + Intergenic
1175427040 20:58874615-58874637 AGGCAGGCCAGAAGCTAAGATGG - Intronic
1175427049 20:58874663-58874685 AGGCAGGCCAGGAGCTAAGATGG - Intronic
1179161612 21:38904069-38904091 AGGGAGGCCAGTGGCACAGAGGG - Intergenic
1179282632 21:39947191-39947213 AGCCAGGCAATGGGCCAAGAGGG - Intergenic
953964973 3:47297362-47297384 AGTCAGGCCATCAGCATTGAAGG + Intronic
954362833 3:50131346-50131368 ATGCAGGAAATCAGCAAAGAGGG - Intergenic
957058721 3:75464126-75464148 AGGCTGGCGATAGGCACAGAGGG - Intergenic
960233540 3:115255438-115255460 AGGCTGGAGAACGGCAAAGATGG - Intergenic
962055224 3:131864635-131864657 AGTCATGCCATCTGCAAACAGGG + Intronic
964080106 3:152744176-152744198 AGGCAGGTAGTCAGCAAAGAAGG - Intergenic
964339977 3:155698028-155698050 AGCCAGGCCAGCGGGTAAGAGGG + Intronic
970365057 4:15350112-15350134 AGGCAGGCAAGCAGGAAAGAAGG + Intronic
973893183 4:55388065-55388087 AGGCAGGCCAAGGGCAAAGAAGG + Intergenic
974747723 4:66098097-66098119 AGGAAGGCCATCTGCAAACCAGG - Intergenic
974752042 4:66154238-66154260 TGGCAGGCCATCGACCATGAAGG + Intergenic
975815185 4:78209850-78209872 AGGCAGGTCAACAGTAAAGAAGG - Intronic
976461672 4:85319711-85319733 AGGCAGTGCATGGGCAAATATGG - Intergenic
977006350 4:91572506-91572528 TGTCAGGCAAACGGCAAAGACGG + Intronic
979042494 4:115815872-115815894 AATCATGCCATCTGCAAAGAGGG - Intergenic
982329416 4:154164552-154164574 AAGCAGGCCAATGGCAAACACGG + Intergenic
982528310 4:156506388-156506410 AGGCAGGAGAACAGCAAAGATGG - Intergenic
984766204 4:183402390-183402412 AGGCAGGCACTGGGCAGAGAGGG - Intergenic
985866201 5:2516386-2516408 AGGCAGTCTATCGGCAAAAGAGG - Intergenic
985977281 5:3430230-3430252 AGTCAGGCCATGGGCATAGCAGG + Intergenic
986016607 5:3762943-3762965 AGGCAGGCCATCGCTGATGATGG - Intergenic
986053460 5:4112111-4112133 AGGCAGGCCATCTGCAAGCCAGG - Intergenic
986928792 5:12794031-12794053 AGGCAGGCCATTCACAAAGTGGG + Intergenic
987834620 5:23145781-23145803 AGGCTGGAGAGCGGCAAAGATGG + Intergenic
990096962 5:52127737-52127759 AGTCATGTCATCTGCAAAGAAGG - Intergenic
991149794 5:63354179-63354201 ATGAAGGCCATTGACAAAGATGG + Intergenic
992090208 5:73310399-73310421 ATGCAGCCCATCTGTAAAGAAGG + Intergenic
995003094 5:107158552-107158574 AGGCTGGACAGCCGCAAAGATGG - Intergenic
996965818 5:129306361-129306383 AGGCAGGAGAACAGCAAAGATGG + Intergenic
998599887 5:143574820-143574842 AGGGAGGCCAGGGGAAAAGAAGG - Intergenic
1002516864 5:179765456-179765478 AGGCAGTCCATTGGAAGAGATGG - Exonic
1004334990 6:14756444-14756466 AGGCAGGGCAGGGACAAAGAAGG - Intergenic
1004707121 6:18134870-18134892 AGACAGGCCAAGGACAAAGATGG + Intronic
1004776298 6:18849373-18849395 GGGCAGGTCTTCGGCAAAGATGG - Intergenic
1009700398 6:67170295-67170317 AGTCATGTCATCTGCAAAGAGGG - Intergenic
1010836614 6:80596030-80596052 AGGCAGGTCATAAGGAAAGAAGG + Intergenic
1011346148 6:86371202-86371224 AGGGAGGCCTTAGGCCAAGATGG + Intergenic
1011711400 6:90058185-90058207 AGTCATGTCATCTGCAAAGAGGG - Intronic
1012757577 6:103251333-103251355 AATCATGCCATCTGCAAAGAGGG - Intergenic
1015136922 6:129882815-129882837 AGGCTGGAGAGCGGCAAAGATGG + Intergenic
1016374034 6:143402315-143402337 AGGCAGGACAACGGGAAAGTGGG + Intergenic
1017525802 6:155240572-155240594 AGTCAGGCCAACGGCATGGAAGG + Exonic
1017682938 6:156882325-156882347 AGGGAGCCCATGGGCAAACAGGG - Intronic
1018653883 6:166013647-166013669 AGGACGGACATCGTCAAAGAAGG + Intergenic
1019149145 6:169992877-169992899 AGGCGGGCCATGGGCCAAGCAGG + Intergenic
1025992883 7:66508875-66508897 AGGCAGGCAATTGGGAAGGAAGG - Intergenic
1028177042 7:87671826-87671848 AGTCAGGCAAACAGCAAAGATGG + Intronic
1028459272 7:91072320-91072342 AGGCTGGAGAACGGCAAAGATGG - Intronic
1032728674 7:134616091-134616113 AAGCAGGCCTTGGCCAAAGACGG - Intergenic
1032944626 7:136835269-136835291 AGTCATGTCATCTGCAAAGAGGG - Intergenic
1033996729 7:147359401-147359423 GAGCAGGCTATAGGCAAAGAAGG - Intronic
1034762643 7:153687469-153687491 AGGCAGGTGATTGGCAAGGAGGG + Intergenic
1035692310 8:1568286-1568308 ATGGAGGCCACAGGCAAAGACGG - Intronic
1039103280 8:33963659-33963681 AGTCATGTCATCTGCAAAGAGGG + Intergenic
1039554222 8:38465604-38465626 AGGCAGGCCATCGGCAAAGACGG + Intronic
1039931120 8:41990248-41990270 ATCCAGGCCATGAGCAAAGAAGG + Intronic
1044356058 8:91224528-91224550 AGGCTGGACAGCAGCAAAGATGG + Intronic
1046678446 8:117138871-117138893 AGGCAGGCCATAAGAATAGAGGG + Intronic
1050659747 9:7871402-7871424 AGGCAGACCATGGTGAAAGAGGG + Intronic
1050982415 9:12036597-12036619 AGGCTGGACAGCAGCAAAGATGG - Intergenic
1051257411 9:15228491-15228513 TGGGAGGCCTTCAGCAAAGATGG + Intronic
1051590666 9:18774150-18774172 AGGCAGGGCATCGGGGAAGGAGG - Intronic
1053146524 9:35715710-35715732 AGGCAGGGTAGCAGCAAAGAAGG + Intronic
1054680489 9:67911760-67911782 AGGAAAGCTCTCGGCAAAGAGGG + Intergenic
1058374391 9:104305691-104305713 AGGCTGGAGATCAGCAAAGATGG - Intergenic
1061924563 9:133799589-133799611 AGGCAGGCCCTTTGCAATGATGG - Intronic
1062166490 9:135110255-135110277 AGGCAGGCCATGGTCAGAGCAGG - Intronic
1186361478 X:8846489-8846511 AGGCTGGCACTTGGCAAAGAGGG - Intergenic
1186563935 X:10642229-10642251 AGTCATGTCATCTGCAAAGAGGG - Intronic
1187020152 X:15373251-15373273 TGTAAGGCCATCAGCAAAGAAGG + Intronic
1187776455 X:22764808-22764830 AATCAGGCCATCTGCAAACAGGG + Intergenic
1189219781 X:39361738-39361760 TAGCAGGCCATGGGCTAAGAAGG + Intergenic
1190774942 X:53545076-53545098 AGGCAGGCCATCAGGAGAGAGGG + Exonic
1197406818 X:126064194-126064216 AGGCATGTCATTTGCAAAGAGGG - Intergenic
1200708817 Y:6465672-6465694 AGGCATGCCATCATCACAGATGG - Intergenic
1200940095 Y:8772026-8772048 AGGCTGGCCATCACCACAGATGG - Intergenic
1200985066 Y:9295265-9295287 AGGCTTGCCATCGCCACAGATGG - Intergenic
1201025295 Y:9699037-9699059 AGGCATGCCATCATCACAGATGG + Intergenic
1201260949 Y:12158620-12158642 AGGCTGGCCATGGGCAGTGAGGG - Intergenic
1201970035 Y:19782002-19782024 AGTCATGTCATCTGCAAAGAGGG - Intergenic
1202125380 Y:21564920-21564942 AGGCTTGCCATCGCCACAGACGG + Intergenic
1202153628 Y:21864472-21864494 AGGCTTGCCATCGCCACAGACGG - Intergenic