ID: 1039554223

View in Genome Browser
Species Human (GRCh38)
Location 8:38465608-38465630
Sequence AGGCCATCGGCAAAGACGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039554216_1039554223 17 Left 1039554216 8:38465568-38465590 CCACTGGGGGTAGGATATGTAAA 0: 1
1: 0
2: 0
3: 8
4: 76
Right 1039554223 8:38465608-38465630 AGGCCATCGGCAAAGACGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 54
1039554215_1039554223 18 Left 1039554215 8:38465567-38465589 CCCACTGGGGGTAGGATATGTAA 0: 1
1: 0
2: 0
3: 6
4: 53
Right 1039554223 8:38465608-38465630 AGGCCATCGGCAAAGACGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 54
1039554214_1039554223 23 Left 1039554214 8:38465562-38465584 CCTAACCCACTGGGGGTAGGATA 0: 1
1: 0
2: 2
3: 5
4: 74
Right 1039554223 8:38465608-38465630 AGGCCATCGGCAAAGACGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039554223 Original CRISPR AGGCCATCGGCAAAGACGGC CGG Intronic
906306705 1:44724383-44724405 AGGCCATCGGGTAAGCGGGCAGG + Exonic
912354001 1:109041134-109041156 AGGCCATGGGCAAAGGGGGCGGG - Intronic
919420217 1:197360742-197360764 ATGCCATCTGCAAAGAGGACTGG + Intronic
1063959295 10:11293534-11293556 AGGCCAGGGGCAGAGAGGGCTGG + Intronic
1065069181 10:22004074-22004096 AGTCCATCAGCAAAGAAGACAGG + Intergenic
1065520516 10:26567097-26567119 AGGCCAAGGGCACAGGCGGCGGG + Exonic
1072444631 10:95488182-95488204 AGGCTATTGGCAAAGGCTGCTGG + Intronic
1078180163 11:9004311-9004333 CGGCCAGCGGCAGAGATGGCCGG - Intergenic
1084181688 11:67450098-67450120 AGGGCAAAGGCAAAGACGGCCGG - Intergenic
1090944112 11:131414337-131414359 AGGCCAGAGGCAAAGGCAGCAGG - Intronic
1091548282 12:1518928-1518950 AAGCCATCTGCCAAGACGGTGGG - Intergenic
1111768566 13:92567022-92567044 ATGCCATCTACAAAGACAGCTGG + Intronic
1113761561 13:112851308-112851330 AGGCCATCCGCACAGCCGACGGG + Intronic
1121212220 14:92215872-92215894 AGGCCATTGGCACAACCGGCTGG - Intergenic
1121733289 14:96201362-96201384 AGGCCAGAGGCAGAGAAGGCAGG + Intergenic
1121795698 14:96733451-96733473 AGGCATCCGGCCAAGACGGCTGG + Intergenic
1122957290 14:105076661-105076683 AGGCCATGGGCCAAGGAGGCTGG + Intergenic
1128390268 15:67178003-67178025 AGGCCAGTGGCAAAGTCTGCAGG - Intronic
1129767327 15:78178681-78178703 AGGCCATCGACGAGGAAGGCTGG - Exonic
1143520568 17:7441992-7442014 AGGCCATCAGCAAAGCTGGAGGG - Intronic
1150661072 17:67079668-67079690 AGGCAATGGGCAAATATGGCTGG - Intronic
1150735724 17:67736442-67736464 AGGCCATCGGTAAACAAGGGAGG - Intronic
1151324303 17:73369398-73369420 AAGGCCTCGGCCAAGACGGCGGG + Intronic
1152666852 17:81575599-81575621 AAGCAATCGGCAAGGACAGCTGG + Intronic
1160663387 19:311933-311955 AGCCCATCTGCAAACACGGCCGG + Exonic
1160689375 19:454291-454313 AGACCCACGGCAAAGTCGGCGGG + Intronic
1162061355 19:8097369-8097391 ATGCCATTGGCACAGATGGCGGG + Exonic
1167708970 19:51098682-51098704 TGGCCATCGGCAAGGGCCGCCGG - Exonic
1167781468 19:51601606-51601628 TGGCCATCGGCAAGGGCCGCCGG + Intergenic
926284715 2:11479569-11479591 AGGCCTTCCCCAAAAACGGCGGG - Intergenic
927731253 2:25473918-25473940 AGACCATCGGCAGAGCCGACTGG - Intronic
928067956 2:28185814-28185836 AGGCCATCTACAAAGACCACTGG + Intronic
929552764 2:42904878-42904900 AGGCCAAGGGCAAAGGAGGCTGG + Intergenic
931806799 2:65815015-65815037 AGGGCATAGGCTAAGACGGGGGG - Intergenic
1170041940 20:12048407-12048429 AAGTCATTGGCAAAGAGGGCAGG + Intergenic
1172917209 20:38452047-38452069 AGGCCCTCGCCAGAGATGGCTGG - Intergenic
1174422979 20:50412335-50412357 GCTCCTTCGGCAAAGACGGCTGG + Intergenic
1176045619 20:63091188-63091210 GGGCCATCAGCCAGGACGGCCGG - Intergenic
1182106257 22:27691893-27691915 AGGGCATGGGCACAGAGGGCAGG - Intergenic
964590470 3:158357816-158357838 TGGCCATGGGCAAAGACTTCAGG + Intronic
968359850 3:198139211-198139233 AGGCCATCAGCACTGAAGGCCGG + Intergenic
986323957 5:6657688-6657710 AGGGCATCCCCAGAGACGGCAGG + Intronic
991202697 5:64012799-64012821 AGGCCATGGACAATGGCGGCTGG - Intergenic
993739947 5:91526069-91526091 AAGCCATAGGAAAAGACTGCAGG - Intergenic
1010126114 6:72433760-72433782 AGGCCATCTGCCAAGAAGGATGG + Intergenic
1010621118 6:78076491-78076513 AGGCGGTCGGGAAAGACAGCTGG - Intergenic
1018756740 6:166856335-166856357 AGGACAAGGGTAAAGACGGCTGG + Intronic
1020157838 7:5741330-5741352 AGGCCATCGAAGAAGACTGCTGG - Exonic
1029235421 7:99112305-99112327 AGCCCATCTGCAAAGACTGGGGG + Intronic
1029880085 7:103798949-103798971 AGGCCCTGGGCAAAGACCGAGGG - Intronic
1033996727 7:147359397-147359419 AGGCTATAGGCAAAGAAGGGTGG - Intronic
1036813486 8:11884401-11884423 TGGCATTCAGCAAAGACGGCCGG + Intergenic
1037802849 8:22044542-22044564 AGGCCGTCGGCCAAGAGGGGCGG + Intronic
1039554223 8:38465608-38465630 AGGCCATCGGCAAAGACGGCCGG + Intronic
1042814027 8:72858729-72858751 AGGCCACTGGCAATGATGGCAGG - Intronic
1048846771 8:138609779-138609801 AGGCCATGTGCACAGAAGGCAGG + Intronic
1194953363 X:100152907-100152929 AGCCCATCAGCAAAGGTGGCAGG + Intergenic
1200121181 X:153791483-153791505 AGGCCTTCGGAAAGGACTGCTGG + Intronic