ID: 1039554752

View in Genome Browser
Species Human (GRCh38)
Location 8:38467943-38467965
Sequence CAAGCCCGCCCCAGATCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039554745_1039554752 3 Left 1039554745 8:38467917-38467939 CCGGCGCCGGGGGCCGCTCGGGA 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1039554752 8:38467943-38467965 CAAGCCCGCCCCAGATCCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 73
1039554746_1039554752 -3 Left 1039554746 8:38467923-38467945 CCGGGGGCCGCTCGGGACGCCAA 0: 1
1: 0
2: 0
3: 2
4: 85
Right 1039554752 8:38467943-38467965 CAAGCCCGCCCCAGATCCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 73
1039554741_1039554752 13 Left 1039554741 8:38467907-38467929 CCGGGAGGCTCCGGCGCCGGGGG 0: 1
1: 0
2: 0
3: 31
4: 294
Right 1039554752 8:38467943-38467965 CAAGCCCGCCCCAGATCCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 73
1039554747_1039554752 -10 Left 1039554747 8:38467930-38467952 CCGCTCGGGACGCCAAGCCCGCC 0: 1
1: 0
2: 1
3: 8
4: 90
Right 1039554752 8:38467943-38467965 CAAGCCCGCCCCAGATCCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039554752 Original CRISPR CAAGCCCGCCCCAGATCCGG GGG Intronic
911498773 1:98661535-98661557 CCAGCCCGCCCCAGGCCAGGTGG + Intergenic
1064032998 10:11894775-11894797 CAAGCTCCCCCCACTTCCGGTGG - Intergenic
1075951236 10:126479440-126479462 CCTGCCCATCCCAGATCCGGAGG + Intronic
1076736659 10:132462100-132462122 CCAGCCCGCCCCGGTTCCGGAGG - Intergenic
1077300815 11:1846149-1846171 GAAGCCCAGCCCTGATCCGGGGG - Intergenic
1081565750 11:44260076-44260098 CAAGCACACCCCAGATGCAGGGG + Intergenic
1085514387 11:77103858-77103880 CAACCCTGCCCCATATCCTGAGG - Intronic
1089452691 11:118608550-118608572 CAGCCCCGCCCCAGAGCCGTGGG - Intronic
1091286769 11:134412299-134412321 CGAGCCCGCGCCAGCGCCGGCGG + Intergenic
1094184479 12:27626392-27626414 CAAGCCCTGCCCAGATGAGGTGG - Intronic
1103898661 12:124291800-124291822 CAAGCACTCCCCATATCAGGGGG - Intronic
1104064258 12:125293825-125293847 CAAGCCAGCCCCAATTCAGGGGG - Intronic
1110364713 13:74669184-74669206 CAAGCCCACCACAGACCCAGAGG + Intergenic
1113945117 13:114039642-114039664 CAAGCCTGCACCAGCTCCTGTGG - Intronic
1118806044 14:69237733-69237755 CAAGCCCTCCTCAGAGCCGATGG - Exonic
1121716355 14:96078787-96078809 CCTGCCCGCCCCAGCTCAGGAGG + Intronic
1122599785 14:102915510-102915532 CAACCCCACCCCAGATGGGGAGG - Intergenic
1122976911 14:105174521-105174543 CAAGGCCTCCCCACCTCCGGGGG + Intronic
1132299977 15:100769232-100769254 CAACTCCGCCCCAGATCCCCAGG + Intergenic
1132552407 16:559029-559051 CACGCCCACCCCAGAACCAGGGG + Intergenic
1132778502 16:1610488-1610510 CAAGCCCGCCCCAGCCTCGATGG + Intronic
1137496216 16:48971394-48971416 CAAGCCCTCCCCAGACCGGAAGG - Intergenic
1141264587 16:82485016-82485038 CAAGCCCCCCACAGATACTGAGG - Intergenic
1142190456 16:88714939-88714961 CAAGCCCGGCCCAGGACAGGTGG - Intronic
1142283988 16:89164096-89164118 CAAGCCCTCCCAAGATGGGGGGG - Intergenic
1142346499 16:89557461-89557483 CACGACCGCCCCAGTTCCTGTGG + Exonic
1142605950 17:1081126-1081148 CAAGGCCGCCCAAGATCCCGGGG - Intronic
1144642647 17:16946090-16946112 CAAGCCATCCCCAAATGCGGAGG - Intronic
1147255224 17:39177298-39177320 CCAGCCCGCCCCAGAAGCCGAGG + Intronic
1148090945 17:45022163-45022185 CAGGCCCGCGCCCGAGCCGGCGG - Intergenic
1152088232 17:78232744-78232766 CAGGCTGGCCCCAGCTCCGGAGG - Intronic
1152203101 17:78958582-78958604 CCAGCCCACCTCAGATCCTGGGG - Intergenic
1152353235 17:79794845-79794867 CAGGCCCCCCCCAGAGCTGGGGG + Exonic
1156497859 18:37537809-37537831 CAAGACCCTCCCAGATCAGGTGG - Intronic
1159320165 18:66838184-66838206 CAAGGACACCCCAGATCCTGGGG + Intergenic
1162964306 19:14148826-14148848 CAAGCCAGCCCCAGCTCCCCGGG + Exonic
1163884947 19:19957042-19957064 CAAGCCCACCCCAGAGCTTGGGG + Intergenic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1167175446 19:47861035-47861057 CAGGGCCACCCCAGGTCCGGGGG - Intergenic
931036626 2:58251478-58251500 CACGCCAGCCCCAGTCCCGGCGG + Intergenic
934857137 2:97736602-97736624 CAAGCCTGCCGCAGCTCCAGGGG + Intronic
946577230 2:221088781-221088803 CAAGCCTGCCCCAAATCAGAAGG + Intergenic
948158236 2:235801722-235801744 CAAGCCCGCCCCTCCTCCCGGGG - Intronic
948705496 2:239789815-239789837 TCACCCCGCCCCAGATCCTGGGG + Intronic
1171421425 20:25020351-25020373 CAAGCACTCCCCAGATCCATGGG + Intronic
1172582964 20:36063295-36063317 CAAACCTGCCCCATCTCCGGGGG - Intergenic
1172775668 20:37405290-37405312 CAGGCCCGGCCCAGAGCCAGGGG - Exonic
1172848687 20:37945068-37945090 CAAGTCCGCCCCAGGGCCTGGGG + Exonic
1182661741 22:31929930-31929952 CAAGCCCAGCCCAGATCCAAAGG + Intergenic
1183212983 22:36462381-36462403 CAAGCCAGCTCCAGAGCAGGAGG + Intergenic
1185021717 22:48380373-48380395 CAGGCCAGACCCAGAGCCGGGGG - Intergenic
952875566 3:37941674-37941696 CATGCCCGGCCCAAATGCGGTGG - Intronic
961488169 3:127232077-127232099 AAGGCCCGCCCCAGATCTGCAGG - Intergenic
964476724 3:157104247-157104269 CAAGCCCCTCCCAGAGCCAGGGG + Intergenic
967186459 3:186948692-186948714 CCAGCCAGCCTCAGTTCCGGAGG + Intronic
973317771 4:48779812-48779834 AAAGCCCGCCCGAGCTCCGGCGG - Intronic
987778864 5:22405778-22405800 CAAGTCTGCCACAGATCCTGAGG - Intronic
988816158 5:34837056-34837078 CATTCCCTCCCCTGATCCGGAGG - Intergenic
995870970 5:116743030-116743052 CAAGCCTGCCCCAGACCAGAGGG + Intergenic
997710675 5:136001459-136001481 CAAGCCCACACCAGAACCTGTGG - Intergenic
1003569508 6:7246920-7246942 CCAGCCCGCCCCTGAACAGGAGG + Exonic
1006880202 6:37332381-37332403 AAAGCCCTCCCCAGATTCCGGGG - Exonic
1013155699 6:107489961-107489983 CACGCCCGCTCGAGAGCCGGGGG + Exonic
1020127912 7:5543311-5543333 GAAGAGCGCCCCAGATCCGGTGG + Intronic
1027111324 7:75442296-75442318 GCAGCCCGCCCCCGCTCCGGAGG - Intronic
1027283565 7:76626855-76626877 GCAGCCCGCCCCCGCTCCGGAGG - Exonic
1032401676 7:131628676-131628698 CAAGTCAGCCCCATCTCCGGTGG - Intergenic
1034113203 7:148558153-148558175 GAAGGACGCCCCAGATCCTGTGG - Intergenic
1035159281 7:156939304-156939326 CAGGCCCTCCCCAGACCCTGAGG - Intergenic
1039554752 8:38467943-38467965 CAAGCCCGCCCCAGATCCGGGGG + Intronic
1042560515 8:70069969-70069991 CCAGCCAGCCCCAGATCCAAGGG + Intronic
1047729182 8:127712469-127712491 CAAGGCCAACCCAGATCCAGGGG + Intergenic
1049554065 8:143273568-143273590 CAGGCCTGCCCCAGCTGCGGTGG - Intronic
1051193208 9:14535772-14535794 TAAGCCAGCCCCAGAGCCTGGGG - Intergenic
1062461903 9:136665796-136665818 CGTGCGCGCCCCGGATCCGGCGG + Intronic
1189187070 X:39063776-39063798 CAAGGCCACCCCAGCTCTGGAGG - Intergenic
1198534944 X:137575761-137575783 CAAGGCTGGCCCAGATCTGGGGG + Intronic
1199849360 X:151714574-151714596 GAAGCCCTTCCCAGATCCAGTGG - Intergenic