ID: 1039555747

View in Genome Browser
Species Human (GRCh38)
Location 8:38473670-38473692
Sequence CTGGAGCCTGCATATCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039555742_1039555747 9 Left 1039555742 8:38473638-38473660 CCCAGGAACTTTCCTTTGATGGA No data
Right 1039555747 8:38473670-38473692 CTGGAGCCTGCATATCTTTGTGG No data
1039555744_1039555747 -3 Left 1039555744 8:38473650-38473672 CCTTTGATGGAAGACACCTTCTG No data
Right 1039555747 8:38473670-38473692 CTGGAGCCTGCATATCTTTGTGG No data
1039555743_1039555747 8 Left 1039555743 8:38473639-38473661 CCAGGAACTTTCCTTTGATGGAA No data
Right 1039555747 8:38473670-38473692 CTGGAGCCTGCATATCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039555747 Original CRISPR CTGGAGCCTGCATATCTTTG TGG Intergenic
No off target data available for this crispr