ID: 1039556936

View in Genome Browser
Species Human (GRCh38)
Location 8:38483267-38483289
Sequence AAGCAGAAACAGGAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039556936_1039556941 16 Left 1039556936 8:38483267-38483289 CCTTCCTCTTCCTGTTTCTGCTT No data
Right 1039556941 8:38483306-38483328 TAAATTCTAAAGCCCTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039556936 Original CRISPR AAGCAGAAACAGGAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr