ID: 1039557322

View in Genome Browser
Species Human (GRCh38)
Location 8:38485806-38485828
Sequence CAGTGGCAGGGGCTGTGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039557322_1039557330 27 Left 1039557322 8:38485806-38485828 CCACAACACAGCCCCTGCCACTG No data
Right 1039557330 8:38485856-38485878 CCTGTGCCACTTGGCCATTGTGG No data
1039557322_1039557331 28 Left 1039557322 8:38485806-38485828 CCACAACACAGCCCCTGCCACTG No data
Right 1039557331 8:38485857-38485879 CTGTGCCACTTGGCCATTGTGGG No data
1039557322_1039557328 18 Left 1039557322 8:38485806-38485828 CCACAACACAGCCCCTGCCACTG No data
Right 1039557328 8:38485847-38485869 TTCAGAGAGCCTGTGCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039557322 Original CRISPR CAGTGGCAGGGGCTGTGTTG TGG (reversed) Intergenic
No off target data available for this crispr