ID: 1039558090

View in Genome Browser
Species Human (GRCh38)
Location 8:38491268-38491290
Sequence CAGTCTGTGCATTCAGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039558090_1039558095 12 Left 1039558090 8:38491268-38491290 CCCTGTACTGAATGCACAGACTG No data
Right 1039558095 8:38491303-38491325 TATAGACATTTATTGTCTCATGG No data
1039558090_1039558096 13 Left 1039558090 8:38491268-38491290 CCCTGTACTGAATGCACAGACTG No data
Right 1039558096 8:38491304-38491326 ATAGACATTTATTGTCTCATGGG No data
1039558090_1039558098 21 Left 1039558090 8:38491268-38491290 CCCTGTACTGAATGCACAGACTG No data
Right 1039558098 8:38491312-38491334 TTATTGTCTCATGGGTCTGGAGG No data
1039558090_1039558097 18 Left 1039558090 8:38491268-38491290 CCCTGTACTGAATGCACAGACTG No data
Right 1039558097 8:38491309-38491331 CATTTATTGTCTCATGGGTCTGG No data
1039558090_1039558099 25 Left 1039558090 8:38491268-38491290 CCCTGTACTGAATGCACAGACTG No data
Right 1039558099 8:38491316-38491338 TGTCTCATGGGTCTGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039558090 Original CRISPR CAGTCTGTGCATTCAGTACA GGG (reversed) Intergenic
No off target data available for this crispr