ID: 1039561291

View in Genome Browser
Species Human (GRCh38)
Location 8:38514298-38514320
Sequence CCTGCTGAACAGATGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039561279_1039561291 27 Left 1039561279 8:38514248-38514270 CCAGGTAGGGTTACCAGGAGAGG 0: 1
1: 0
2: 0
3: 19
4: 146
Right 1039561291 8:38514298-38514320 CCTGCTGAACAGATGGTGCAGGG No data
1039561283_1039561291 14 Left 1039561283 8:38514261-38514283 CCAGGAGAGGACTGGGCAGACCT 0: 1
1: 0
2: 7
3: 34
4: 323
Right 1039561291 8:38514298-38514320 CCTGCTGAACAGATGGTGCAGGG No data
1039561277_1039561291 29 Left 1039561277 8:38514246-38514268 CCCCAGGTAGGGTTACCAGGAGA 0: 1
1: 0
2: 1
3: 6
4: 114
Right 1039561291 8:38514298-38514320 CCTGCTGAACAGATGGTGCAGGG No data
1039561278_1039561291 28 Left 1039561278 8:38514247-38514269 CCCAGGTAGGGTTACCAGGAGAG 0: 1
1: 0
2: 1
3: 6
4: 127
Right 1039561291 8:38514298-38514320 CCTGCTGAACAGATGGTGCAGGG No data
1039561286_1039561291 -6 Left 1039561286 8:38514281-38514303 CCTTTGGGAAGCTGTGCCCTGCT 0: 1
1: 0
2: 0
3: 26
4: 203
Right 1039561291 8:38514298-38514320 CCTGCTGAACAGATGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039561291 Original CRISPR CCTGCTGAACAGATGGTGCA GGG Intronic
No off target data available for this crispr