ID: 1039569641

View in Genome Browser
Species Human (GRCh38)
Location 8:38576504-38576526
Sequence TAGAGTTTTAAAGATGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039569638_1039569641 14 Left 1039569638 8:38576467-38576489 CCTCTTGGGGAGAGGGGTGGTCA No data
Right 1039569641 8:38576504-38576526 TAGAGTTTTAAAGATGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039569641 Original CRISPR TAGAGTTTTAAAGATGCCCC AGG Intergenic
No off target data available for this crispr