ID: 1039570811

View in Genome Browser
Species Human (GRCh38)
Location 8:38585136-38585158
Sequence TCTTACATGCAGACGTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039570805_1039570811 8 Left 1039570805 8:38585105-38585127 CCCAAGCAAGCCAATGTTGCTAC No data
Right 1039570811 8:38585136-38585158 TCTTACATGCAGACGTTGGGTGG No data
1039570806_1039570811 7 Left 1039570806 8:38585106-38585128 CCAAGCAAGCCAATGTTGCTACC No data
Right 1039570811 8:38585136-38585158 TCTTACATGCAGACGTTGGGTGG No data
1039570807_1039570811 -2 Left 1039570807 8:38585115-38585137 CCAATGTTGCTACCACAGTTGTC No data
Right 1039570811 8:38585136-38585158 TCTTACATGCAGACGTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039570811 Original CRISPR TCTTACATGCAGACGTTGGG TGG Intergenic
No off target data available for this crispr