ID: 1039571249

View in Genome Browser
Species Human (GRCh38)
Location 8:38588118-38588140
Sequence GCAGAGTTGATTGCTGCATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039571249_1039571251 -5 Left 1039571249 8:38588118-38588140 CCCAATGCAGCAATCAACTCTGC No data
Right 1039571251 8:38588136-38588158 TCTGCAGCATTCTCAATAGCAGG No data
1039571249_1039571252 0 Left 1039571249 8:38588118-38588140 CCCAATGCAGCAATCAACTCTGC No data
Right 1039571252 8:38588141-38588163 AGCATTCTCAATAGCAGGTCAGG No data
1039571249_1039571253 1 Left 1039571249 8:38588118-38588140 CCCAATGCAGCAATCAACTCTGC No data
Right 1039571253 8:38588142-38588164 GCATTCTCAATAGCAGGTCAGGG No data
1039571249_1039571257 29 Left 1039571249 8:38588118-38588140 CCCAATGCAGCAATCAACTCTGC No data
Right 1039571257 8:38588170-38588192 CGTTCAACACTAGAATTCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039571249 Original CRISPR GCAGAGTTGATTGCTGCATT GGG (reversed) Intergenic
No off target data available for this crispr