ID: 1039571253

View in Genome Browser
Species Human (GRCh38)
Location 8:38588142-38588164
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039571247_1039571253 7 Left 1039571247 8:38588112-38588134 CCCTTACCCAATGCAGCAATCAA No data
Right 1039571253 8:38588142-38588164 GCATTCTCAATAGCAGGTCAGGG No data
1039571245_1039571253 26 Left 1039571245 8:38588093-38588115 CCACTGGGTGAGTCTAGTCCCCT No data
Right 1039571253 8:38588142-38588164 GCATTCTCAATAGCAGGTCAGGG No data
1039571248_1039571253 6 Left 1039571248 8:38588113-38588135 CCTTACCCAATGCAGCAATCAAC No data
Right 1039571253 8:38588142-38588164 GCATTCTCAATAGCAGGTCAGGG No data
1039571250_1039571253 0 Left 1039571250 8:38588119-38588141 CCAATGCAGCAATCAACTCTGCA No data
Right 1039571253 8:38588142-38588164 GCATTCTCAATAGCAGGTCAGGG No data
1039571249_1039571253 1 Left 1039571249 8:38588118-38588140 CCCAATGCAGCAATCAACTCTGC No data
Right 1039571253 8:38588142-38588164 GCATTCTCAATAGCAGGTCAGGG No data
1039571246_1039571253 8 Left 1039571246 8:38588111-38588133 CCCCTTACCCAATGCAGCAATCA No data
Right 1039571253 8:38588142-38588164 GCATTCTCAATAGCAGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039571253 Original CRISPR GCATTCTCAATAGCAGGTCA GGG Intergenic
No off target data available for this crispr