ID: 1039571257

View in Genome Browser
Species Human (GRCh38)
Location 8:38588170-38588192
Sequence CGTTCAACACTAGAATTCAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039571249_1039571257 29 Left 1039571249 8:38588118-38588140 CCCAATGCAGCAATCAACTCTGC No data
Right 1039571257 8:38588170-38588192 CGTTCAACACTAGAATTCAACGG No data
1039571250_1039571257 28 Left 1039571250 8:38588119-38588141 CCAATGCAGCAATCAACTCTGCA No data
Right 1039571257 8:38588170-38588192 CGTTCAACACTAGAATTCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039571257 Original CRISPR CGTTCAACACTAGAATTCAA CGG Intergenic
No off target data available for this crispr