ID: 1039572838

View in Genome Browser
Species Human (GRCh38)
Location 8:38601086-38601108
Sequence GGAGACTGCTCGGGAAGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039572838_1039572845 30 Left 1039572838 8:38601086-38601108 CCACAGCTTCCCGAGCAGTCTCC No data
Right 1039572845 8:38601139-38601161 GCCCCGCCCCGCTCGCGATTTGG No data
1039572838_1039572842 -1 Left 1039572838 8:38601086-38601108 CCACAGCTTCCCGAGCAGTCTCC No data
Right 1039572842 8:38601108-38601130 CAAACATATATTACATTCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039572838 Original CRISPR GGAGACTGCTCGGGAAGCTG TGG (reversed) Intergenic