ID: 1039572838 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:38601086-38601108 |
| Sequence | GGAGACTGCTCGGGAAGCTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1039572838_1039572845 | 30 | Left | 1039572838 | 8:38601086-38601108 | CCACAGCTTCCCGAGCAGTCTCC | No data | ||
| Right | 1039572845 | 8:38601139-38601161 | GCCCCGCCCCGCTCGCGATTTGG | No data | ||||
| 1039572838_1039572842 | -1 | Left | 1039572838 | 8:38601086-38601108 | CCACAGCTTCCCGAGCAGTCTCC | No data | ||
| Right | 1039572842 | 8:38601108-38601130 | CAAACATATATTACATTCGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1039572838 | Original CRISPR | GGAGACTGCTCGGGAAGCTG TGG (reversed) | Intergenic | ||