ID: 1039572841

View in Genome Browser
Species Human (GRCh38)
Location 8:38601107-38601129
Sequence CTTCGAATGTAATATATGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039572841_1039572854 19 Left 1039572841 8:38601107-38601129 CCAAACATATATTACATTCGAAG No data
Right 1039572854 8:38601149-38601171 GCTCGCGATTTGGCCCCTCGGGG 0: 1
1: 1
2: 0
3: 0
4: 17
1039572841_1039572852 17 Left 1039572841 8:38601107-38601129 CCAAACATATATTACATTCGAAG No data
Right 1039572852 8:38601147-38601169 CCGCTCGCGATTTGGCCCCTCGG 0: 1
1: 1
2: 0
3: 0
4: 13
1039572841_1039572853 18 Left 1039572841 8:38601107-38601129 CCAAACATATATTACATTCGAAG No data
Right 1039572853 8:38601148-38601170 CGCTCGCGATTTGGCCCCTCGGG 0: 1
1: 1
2: 0
3: 1
4: 12
1039572841_1039572845 9 Left 1039572841 8:38601107-38601129 CCAAACATATATTACATTCGAAG No data
Right 1039572845 8:38601139-38601161 GCCCCGCCCCGCTCGCGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039572841 Original CRISPR CTTCGAATGTAATATATGTT TGG (reversed) Intergenic