ID: 1039572845

View in Genome Browser
Species Human (GRCh38)
Location 8:38601139-38601161
Sequence GCCCCGCCCCGCTCGCGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039572841_1039572845 9 Left 1039572841 8:38601107-38601129 CCAAACATATATTACATTCGAAG No data
Right 1039572845 8:38601139-38601161 GCCCCGCCCCGCTCGCGATTTGG No data
1039572840_1039572845 20 Left 1039572840 8:38601096-38601118 CCGAGCAGTCTCCAAACATATAT No data
Right 1039572845 8:38601139-38601161 GCCCCGCCCCGCTCGCGATTTGG No data
1039572839_1039572845 21 Left 1039572839 8:38601095-38601117 CCCGAGCAGTCTCCAAACATATA No data
Right 1039572845 8:38601139-38601161 GCCCCGCCCCGCTCGCGATTTGG No data
1039572838_1039572845 30 Left 1039572838 8:38601086-38601108 CCACAGCTTCCCGAGCAGTCTCC No data
Right 1039572845 8:38601139-38601161 GCCCCGCCCCGCTCGCGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039572845 Original CRISPR GCCCCGCCCCGCTCGCGATT TGG Intergenic