ID: 1039572853

View in Genome Browser
Species Human (GRCh38)
Location 8:38601148-38601170
Sequence CGCTCGCGATTTGGCCCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 15
Summary {0: 1, 1: 1, 2: 0, 3: 1, 4: 12}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039572840_1039572853 29 Left 1039572840 8:38601096-38601118 CCGAGCAGTCTCCAAACATATAT No data
Right 1039572853 8:38601148-38601170 CGCTCGCGATTTGGCCCCTCGGG 0: 1
1: 1
2: 0
3: 1
4: 12
1039572841_1039572853 18 Left 1039572841 8:38601107-38601129 CCAAACATATATTACATTCGAAG No data
Right 1039572853 8:38601148-38601170 CGCTCGCGATTTGGCCCCTCGGG 0: 1
1: 1
2: 0
3: 1
4: 12
1039572839_1039572853 30 Left 1039572839 8:38601095-38601117 CCCGAGCAGTCTCCAAACATATA No data
Right 1039572853 8:38601148-38601170 CGCTCGCGATTTGGCCCCTCGGG 0: 1
1: 1
2: 0
3: 1
4: 12

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039572853 Original CRISPR CGCTCGCGATTTGGCCCCTC GGG Intergenic