ID: 1039572854

View in Genome Browser
Species Human (GRCh38)
Location 8:38601149-38601171
Sequence GCTCGCGATTTGGCCCCTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 1, 2: 0, 3: 0, 4: 17}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039572843_1039572854 -10 Left 1039572843 8:38601136-38601158 CCCGCCCCGCCCCGCTCGCGATT No data
Right 1039572854 8:38601149-38601171 GCTCGCGATTTGGCCCCTCGGGG 0: 1
1: 1
2: 0
3: 0
4: 17
1039572841_1039572854 19 Left 1039572841 8:38601107-38601129 CCAAACATATATTACATTCGAAG No data
Right 1039572854 8:38601149-38601171 GCTCGCGATTTGGCCCCTCGGGG 0: 1
1: 1
2: 0
3: 0
4: 17
1039572840_1039572854 30 Left 1039572840 8:38601096-38601118 CCGAGCAGTCTCCAAACATATAT No data
Right 1039572854 8:38601149-38601171 GCTCGCGATTTGGCCCCTCGGGG 0: 1
1: 1
2: 0
3: 0
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039572854 Original CRISPR GCTCGCGATTTGGCCCCTCG GGG Intergenic