ID: 1039572930

View in Genome Browser
Species Human (GRCh38)
Location 8:38601614-38601636
Sequence GTCTGGCTTTGGAGTGACGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039572923_1039572930 18 Left 1039572923 8:38601573-38601595 CCAACAAAGACCTCTTTGTGCTG No data
Right 1039572930 8:38601614-38601636 GTCTGGCTTTGGAGTGACGAGGG No data
1039572926_1039572930 -8 Left 1039572926 8:38601599-38601621 CCCATGTAGTTCTGTGTCTGGCT No data
Right 1039572930 8:38601614-38601636 GTCTGGCTTTGGAGTGACGAGGG No data
1039572927_1039572930 -9 Left 1039572927 8:38601600-38601622 CCATGTAGTTCTGTGTCTGGCTT No data
Right 1039572930 8:38601614-38601636 GTCTGGCTTTGGAGTGACGAGGG No data
1039572924_1039572930 8 Left 1039572924 8:38601583-38601605 CCTCTTTGTGCTGCAGCCCATGT No data
Right 1039572930 8:38601614-38601636 GTCTGGCTTTGGAGTGACGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039572930 Original CRISPR GTCTGGCTTTGGAGTGACGA GGG Intergenic
No off target data available for this crispr