ID: 1039583033

View in Genome Browser
Species Human (GRCh38)
Location 8:38682420-38682442
Sequence TTACTTCAGCTGTGGTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039583033_1039583038 27 Left 1039583033 8:38682420-38682442 CCTCAGAACCACAGCTGAAGTAA No data
Right 1039583038 8:38682470-38682492 CAGTGGGAGAACAAATTCCCTGG No data
1039583033_1039583036 11 Left 1039583033 8:38682420-38682442 CCTCAGAACCACAGCTGAAGTAA No data
Right 1039583036 8:38682454-38682476 GCAGCCGTCAGTGAATCAGTGGG No data
1039583033_1039583035 10 Left 1039583033 8:38682420-38682442 CCTCAGAACCACAGCTGAAGTAA No data
Right 1039583035 8:38682453-38682475 CGCAGCCGTCAGTGAATCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039583033 Original CRISPR TTACTTCAGCTGTGGTTCTG AGG (reversed) Intergenic
No off target data available for this crispr