ID: 1039583459

View in Genome Browser
Species Human (GRCh38)
Location 8:38685738-38685760
Sequence CTAAGATGGCACCAGGGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039583454_1039583459 14 Left 1039583454 8:38685701-38685723 CCAGAGTTTCAGATGTCTCTCTC No data
Right 1039583459 8:38685738-38685760 CTAAGATGGCACCAGGGTGTAGG No data
1039583455_1039583459 -8 Left 1039583455 8:38685723-38685745 CCTTTCTTTCTCTCACTAAGATG No data
Right 1039583459 8:38685738-38685760 CTAAGATGGCACCAGGGTGTAGG No data
1039583453_1039583459 15 Left 1039583453 8:38685700-38685722 CCCAGAGTTTCAGATGTCTCTCT No data
Right 1039583459 8:38685738-38685760 CTAAGATGGCACCAGGGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039583459 Original CRISPR CTAAGATGGCACCAGGGTGT AGG Intergenic