ID: 1039588667

View in Genome Browser
Species Human (GRCh38)
Location 8:38728637-38728659
Sequence GGTCCCCAGAGTCGGTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 133}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039588667_1039588674 1 Left 1039588667 8:38728637-38728659 CCTGGGGACCGACTCTGGGGACC 0: 1
1: 0
2: 2
3: 15
4: 133
Right 1039588674 8:38728661-38728683 TCGCCGAAGAGGTAGGAAACGGG 0: 1
1: 0
2: 0
3: 2
4: 64
1039588667_1039588676 3 Left 1039588667 8:38728637-38728659 CCTGGGGACCGACTCTGGGGACC 0: 1
1: 0
2: 2
3: 15
4: 133
Right 1039588676 8:38728663-38728685 GCCGAAGAGGTAGGAAACGGGGG 0: 1
1: 0
2: 0
3: 6
4: 87
1039588667_1039588673 0 Left 1039588667 8:38728637-38728659 CCTGGGGACCGACTCTGGGGACC 0: 1
1: 0
2: 2
3: 15
4: 133
Right 1039588673 8:38728660-38728682 CTCGCCGAAGAGGTAGGAAACGG 0: 1
1: 0
2: 0
3: 3
4: 69
1039588667_1039588669 -10 Left 1039588667 8:38728637-38728659 CCTGGGGACCGACTCTGGGGACC 0: 1
1: 0
2: 2
3: 15
4: 133
Right 1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG 0: 1
1: 0
2: 1
3: 3
4: 61
1039588667_1039588670 -6 Left 1039588667 8:38728637-38728659 CCTGGGGACCGACTCTGGGGACC 0: 1
1: 0
2: 2
3: 15
4: 133
Right 1039588670 8:38728654-38728676 GGGACCCTCGCCGAAGAGGTAGG 0: 1
1: 0
2: 1
3: 11
4: 120
1039588667_1039588675 2 Left 1039588667 8:38728637-38728659 CCTGGGGACCGACTCTGGGGACC 0: 1
1: 0
2: 2
3: 15
4: 133
Right 1039588675 8:38728662-38728684 CGCCGAAGAGGTAGGAAACGGGG 0: 1
1: 0
2: 0
3: 3
4: 41
1039588667_1039588678 20 Left 1039588667 8:38728637-38728659 CCTGGGGACCGACTCTGGGGACC 0: 1
1: 0
2: 2
3: 15
4: 133
Right 1039588678 8:38728680-38728702 CGGGGGACTGCACGTTCCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039588667 Original CRISPR GGTCCCCAGAGTCGGTCCCC AGG (reversed) Intronic
900427847 1:2588567-2588589 GGTCCCCAGACAAGTTCCCCTGG - Exonic
900791443 1:4683624-4683646 GGTACCCACAGTCTTTCCCCCGG + Intronic
900985167 1:6068991-6069013 GGTCCCGAGAGTCTGACCCCAGG + Intronic
901056635 1:6451415-6451437 GGCCCCCAGAGGCGGGCCCTTGG - Intronic
901213535 1:7540282-7540304 GGGCCCCAGCCTGGGTCCCCAGG - Intronic
901801335 1:11709684-11709706 TGTCCCCAGAGTGGGCCCCCAGG - Intronic
902629987 1:17698993-17699015 GGTAGCCAGTGTGGGTCCCCAGG + Intergenic
902871096 1:19314021-19314043 GGACCCCAGAAGCGGTACCCTGG - Intronic
903331483 1:22599281-22599303 GGTCCCCACAGTCACTCACCAGG + Intronic
903850505 1:26302943-26302965 GGAGCCCTGAGTCTGTCCCCAGG - Intronic
904433310 1:30479015-30479037 GGCCCCCAGGGTTGGTCCTCTGG + Intergenic
904753389 1:32754814-32754836 GGTCCCCAGACTCCAGCCCCGGG - Intronic
915507514 1:156367130-156367152 GCCACCCAGAGTCGGACCCCTGG + Intronic
917490909 1:175497705-175497727 GGTACCATGAGTCGGTCCCTTGG + Intronic
923409178 1:233690553-233690575 GAGTCCCAGAGTCAGTCCCCAGG + Intergenic
1065239949 10:23695061-23695083 CGGCCCCAGACTCGGGCCCCCGG + Intronic
1065744524 10:28827421-28827443 TGTCCACAGAGTCAGTCTCCTGG + Intergenic
1073181824 10:101588123-101588145 AACCCCCAGAGTCGGTCCCCGGG + Exonic
1074299593 10:112221470-112221492 GATTCCCAGATTCTGTCCCCAGG - Intergenic
1075105546 10:119537936-119537958 GGTGCCCAGTGTCTCTCCCCAGG + Intronic
1077423752 11:2464929-2464951 AGTGCCCAGAGTTGGTGCCCAGG - Intronic
1081812879 11:45923095-45923117 GGTCCCCGGGGCCGGCCCCCGGG - Exonic
1081981391 11:47269475-47269497 AGAACCCAGTGTCGGTCCCCAGG + Intronic
1083228628 11:61300729-61300751 GGTGCCCAGAGACAGTCTCCTGG + Intronic
1083610297 11:64001079-64001101 GGTCCCCAGGGTCGCTCGCGAGG - Intronic
1083701078 11:64478017-64478039 GCTCTCCAGAGTGGGTTCCCTGG + Intergenic
1084605068 11:70167662-70167684 GGTCCCCAGCCACAGTCCCCAGG + Intronic
1084605077 11:70167688-70167710 GGTCCCCAGCCACAGTCCCCAGG + Intronic
1084605083 11:70167701-70167723 AGTCCCCAGGCACGGTCCCCAGG + Intronic
1085804706 11:79624582-79624604 GGTCCCCCAAATCAGTCCCCAGG - Intergenic
1087132119 11:94677546-94677568 AGTCCCCAGTGTCAGTCCCAAGG + Intergenic
1089183427 11:116598585-116598607 GATCCTCAGAGTCTGGCCCCTGG - Intergenic
1089739726 11:120574030-120574052 AGTCACCAGTGTCGGTCCCAGGG - Intronic
1090059059 11:123448151-123448173 GGTCCACAGAGCCTGGCCCCAGG + Intergenic
1090416589 11:126544600-126544622 GGAACCCAGAGTCGGTGTCCTGG + Intronic
1096271231 12:50167510-50167532 GATCCCCGGAGGCGGTCCCCGGG - Intronic
1097182100 12:57177511-57177533 AGCCCCCAGAGCCGGTCTCCCGG - Exonic
1099157332 12:79194625-79194647 GGTTCTCAAAGTGGGTCCCCTGG - Intronic
1102258767 12:111430861-111430883 GGTCCCCAGGGTCCCTCCCCGGG + Intronic
1104246100 12:127043091-127043113 GGTCCCCAGAGTGTTTTCCCAGG - Intergenic
1105468848 13:20673395-20673417 GGACCCCAGACACTGTCCCCTGG - Intronic
1106248843 13:27969043-27969065 AGCCTCCAGCGTCGGTCCCCAGG - Exonic
1107624991 13:42272562-42272584 GGTCTTCAGAGACGGCCCCCCGG + Intronic
1113965463 13:114150551-114150573 GGTCCCCAGGTGAGGTCCCCAGG - Intergenic
1113965477 13:114150590-114150612 GGTCCCCAGGTGAGGTCCCCAGG - Intergenic
1121052528 14:90828788-90828810 GGTCATGAGAGTGGGTCCCCTGG - Intergenic
1121580478 14:95026074-95026096 GACCCCCAGAGTGGTTCCCCAGG + Intergenic
1121666399 14:95675716-95675738 AGTCCGCACAGACGGTCCCCTGG - Intergenic
1122157078 14:99756168-99756190 GGGCCCCAGAGAAGGACCCCAGG + Intronic
1125399251 15:39282828-39282850 GAGCCTCAGAGTCTGTCCCCTGG - Intergenic
1128119209 15:65133466-65133488 GCTCGCCGGCGTCGGTCCCCGGG + Exonic
1128945506 15:71817422-71817444 GGTCCCCAGAGTGGGTCAGGAGG - Intronic
1129252896 15:74318548-74318570 GTTCCCCAGGATGGGTCCCCAGG - Intronic
1129741958 15:77993619-77993641 GGACCACAGAGTGGGGCCCCAGG - Intronic
1129843747 15:78758851-78758873 GGACCACAGAGTGGGGCCCCAGG + Intergenic
1130258058 15:82334949-82334971 GGACCACAGAGTGGGGCCCCAGG - Intergenic
1132145508 15:99426910-99426932 GATCCCCAGAGTAGCTCCCCGGG - Intergenic
1132891739 16:2208122-2208144 GGCCCCCAGTGTTGGCCCCCAGG + Intronic
1133457868 16:5958855-5958877 GGTCCCCAGAGGAGGTAGCCAGG - Intergenic
1134858512 16:17540365-17540387 GGGCTCCAGAGGTGGTCCCCTGG + Intergenic
1135057326 16:19241679-19241701 GGTCCTCAGAGCCTGCCCCCAGG - Intronic
1136244172 16:28963821-28963843 GGTCCCCAGATTCCATGCCCAGG - Exonic
1136704912 16:32179169-32179191 GGCCCCCAGGTTGGGTCCCCAGG + Intergenic
1136763002 16:32750238-32750260 GGCCCCCAGGTTGGGTCCCCAGG - Intergenic
1136805098 16:33120148-33120170 GGCCCCCAGGTTGGGTCCCCAGG + Intergenic
1140715601 16:77722887-77722909 CGTCTCCAGAGTTGGACCCCAGG + Intronic
1141669619 16:85485006-85485028 GGTCCCCAGGGCCTGGCCCCGGG - Intergenic
1203065154 16_KI270728v1_random:1010560-1010582 GGCCCCCAGGTTGGGTCCCCAGG - Intergenic
1146648799 17:34593517-34593539 GGGCCCCAGAGTCAGTGCTCTGG + Intronic
1151494800 17:74453015-74453037 GGTCCCCAGAGTGGGTGGCTTGG + Intergenic
1151539555 17:74758138-74758160 GTTCCCCAGAGACGGTCACTGGG + Intronic
1151758226 17:76086772-76086794 GGTACTGAGAGTCAGTCCCCAGG + Intronic
1152149545 17:78590306-78590328 GGTTCTCAGAGTGGGGCCCCTGG + Intergenic
1152638680 17:81440601-81440623 GGTCCCCAGAGGCGGTGGCCTGG + Intronic
1160719528 19:591073-591095 GGTCCCCAGGCTGTGTCCCCGGG + Intronic
1162109761 19:8393675-8393697 GGCCCCCAGTGCCGGTCCCTGGG + Intronic
1163713368 19:18860159-18860181 GGTCACCTGAGCCGGTCCCCTGG - Intronic
1163714472 19:18865910-18865932 GGTCATCAGAGTGGGTCTCCTGG + Intronic
1164620503 19:29693108-29693130 GGTCCCCAGAGGCAGCCCCAGGG + Intergenic
1165153182 19:33772685-33772707 GCACCCCAGAGCCGGTCCGCAGG - Exonic
1166268845 19:41701332-41701354 CACCCCCAGAGTCAGTCCCCTGG - Intronic
1167310588 19:48735450-48735472 GGGCCCCTGATCCGGTCCCCGGG + Exonic
1167383916 19:49153206-49153228 TGTCCCCAGAATCTGTCCCAGGG - Intronic
924962330 2:46154-46176 GGGGCCCAGGGTCGTTCCCCGGG + Exonic
926639716 2:15221305-15221327 GGTCCCAAGAGTGTGTCACCTGG + Intronic
926740055 2:16103184-16103206 AGTCCCCAGAGCCGGCCCCCTGG + Intergenic
930693868 2:54391380-54391402 GTTTGCCAGAGTCGTTCCCCAGG - Intergenic
932248579 2:70219715-70219737 GGTCCACAGACTAGGTCGCCAGG + Intronic
932763871 2:74458078-74458100 AGTCCCAAAAGTCGGTCCGCTGG - Intronic
935939229 2:108221122-108221144 GGGCCCCAGAGTCTGTAGCCTGG - Intergenic
936061223 2:109296942-109296964 GCTCCTCAGGGTAGGTCCCCAGG - Intronic
936121685 2:109751527-109751549 GCCCCCCAGATTCTGTCCCCTGG - Intergenic
936223013 2:110619947-110619969 GTCCCCCAGATTCTGTCCCCTGG + Intergenic
941911839 2:170771275-170771297 GGTCCGCAGACTCGGGCGCCCGG - Intergenic
1172437866 20:34942660-34942682 GGTCCTCAGAGTCAGTCCCTGGG - Intronic
1176023681 20:62975203-62975225 GGTCCCAAGAGTGAGTGCCCAGG - Intergenic
1179610371 21:42546206-42546228 GGAACCCAGAGTCAGACCCCAGG - Intronic
1180871617 22:19150029-19150051 GGCCCCCAGAGGCGGCCGCCGGG - Exonic
1181276266 22:21689009-21689031 GGTCCCCAGAGTGAGTCAGCAGG + Intronic
1181600642 22:23949853-23949875 TGTCCCCAGGGCCCGTCCCCTGG + Intergenic
1181607869 22:23991469-23991491 TGTCCCCAGGGCCCGTCCCCTGG - Intergenic
1183062573 22:35345248-35345270 GGTCCCCAGGTTCCATCCCCTGG - Intronic
950041237 3:9920718-9920740 CCTCCCCAGAGTCAGTCCCTCGG + Intronic
956971592 3:74532609-74532631 CGTCCACAGCGTGGGTCCCCTGG + Intergenic
957406002 3:79775840-79775862 GGTCCCTATGGTCAGTCCCCTGG + Intergenic
961723263 3:128909695-128909717 GGTCCCTAGATTCAGGCCCCAGG - Intronic
963782331 3:149498866-149498888 AGTCCCCACAGAGGGTCCCCAGG - Exonic
966890514 3:184404443-184404465 GGTCCGCAGACTCAGTGCCCAGG + Intronic
968735246 4:2291809-2291831 GGGCCCCAGCGTCTGTGCCCTGG + Intronic
992093306 5:73338699-73338721 GGTCCCCTGGGTCGGCCCCCTGG + Intergenic
1002445227 5:179286514-179286536 GCTCTCCAGGGTGGGTCCCCTGG - Intronic
1002560354 5:180077489-180077511 GGTCCCCAGAGTGGGTCGCCAGG + Intergenic
1005421155 6:25652414-25652436 GCGCCCCAGAGTCGGTTCCCGGG - Exonic
1007715458 6:43853061-43853083 GGTACCCAGAGTAGGTGGCCAGG - Intergenic
1007816398 6:44528324-44528346 GCTCCCCAGAGTGGACCCCCTGG - Intergenic
1010465684 6:76165436-76165458 GGTCCCCAGTGTGGGTCCCCAGG - Intergenic
1014632403 6:123803445-123803467 GGTCCTCAAAGTTGGCCCCCTGG + Intergenic
1016431027 6:143986140-143986162 GGTGCCCAGAGTCTGGTCCCAGG - Intronic
1019184476 6:170213147-170213169 GTTCCCCAGGCTCGGTCCCGGGG - Intergenic
1019266413 7:119774-119796 GTTTCCCAGAGTCTGTCCCCGGG + Intergenic
1025194839 7:56924763-56924785 GGTCCCTGGAGCAGGTCCCCCGG - Intergenic
1025677113 7:63652180-63652202 GGTCCCTGGAGCAGGTCCCCCGG + Intergenic
1027233107 7:76283175-76283197 GATCCTCAGAGAAGGTCCCCGGG - Intronic
1028514245 7:91658888-91658910 GGCCTCCAGAGTCTGCCCCCAGG + Intergenic
1029672829 7:102045865-102045887 GGTCCCTGGAGCGGGTCCCCTGG - Intronic
1033669579 7:143478246-143478268 GGTTCCCAGGGTGGGTGCCCTGG + Exonic
1034463069 7:151209238-151209260 GGGCACCAGAGTCTGTCCTCTGG + Intronic
1035056207 7:156038498-156038520 TGTCCCCAGAGGCTGTCCCCTGG + Intergenic
1037033054 8:14133109-14133131 GATCCCCAGGCTCAGTCCCCTGG - Intronic
1037752673 8:21692855-21692877 GGTCCCCAGAGTGGGCAGCCTGG + Exonic
1039588667 8:38728637-38728659 GGTCCCCAGAGTCGGTCCCCAGG - Intronic
1041144592 8:54860641-54860663 GGTCCTCAGACTGCGTCCCCAGG + Intergenic
1045182823 8:99804463-99804485 AGTCCCCAGTTGCGGTCCCCAGG - Intronic
1045435439 8:102158799-102158821 GGTGCCCAGAGCTGGTGCCCTGG - Intergenic
1047572555 8:126115601-126115623 GCTCTCCATAGTCTGTCCCCAGG - Intergenic
1049238202 8:141523227-141523249 GCTCCTCAGAGTCCGTTCCCAGG - Intergenic
1049426338 8:142539566-142539588 GGCCCCCAGGGCAGGTCCCCTGG - Intronic
1049604273 8:143521753-143521775 GGCCCCCAGAAGGGGTCCCCAGG + Intronic
1053020355 9:34690069-34690091 GGTTCCCAGACATGGTCCCCAGG - Intronic
1053462503 9:38281457-38281479 GGTTCTCAGAGTCTGTTCCCTGG + Intergenic
1054948444 9:70822795-70822817 GTTCCCCAAAGTAAGTCCCCTGG + Intronic
1057223070 9:93268180-93268202 TGTCCCCAGACTGGGGCCCCTGG - Intronic
1060283158 9:122227349-122227371 GGTCCCCAGGGCCGGGCCGCTGG + Intronic
1060762547 9:126268021-126268043 GGTCCTCAAAGTGGGTCCCTAGG + Intergenic
1061059645 9:128244081-128244103 GGTGCCCAGAGTCACTCCCCAGG - Intronic
1061144964 9:128792258-128792280 AGTCCTCAGAGCTGGTCCCCAGG + Intronic
1062383287 9:136298036-136298058 AGTCCCCAGCGGCAGTCCCCAGG - Intronic
1062437773 9:136554241-136554263 GGGCCCCAGGGTTGGTCCACAGG - Intergenic
1187337212 X:18391883-18391905 GGACCCCAGAGTCAGGCCTCTGG + Intergenic
1189204479 X:39226250-39226272 GCTCCCCTGGGTCGGTCCACAGG + Intergenic
1189850065 X:45169043-45169065 GGTCCCCTTAATGGGTCCCCTGG - Intronic