ID: 1039588669

View in Genome Browser
Species Human (GRCh38)
Location 8:38728650-38728672
Sequence TCTGGGGACCCTCGCCGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039588667_1039588669 -10 Left 1039588667 8:38728637-38728659 CCTGGGGACCGACTCTGGGGACC 0: 1
1: 0
2: 2
3: 15
4: 133
Right 1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG 0: 1
1: 0
2: 1
3: 3
4: 61
1039588666_1039588669 -9 Left 1039588666 8:38728636-38728658 CCCTGGGGACCGACTCTGGGGAC 0: 1
1: 0
2: 1
3: 13
4: 150
Right 1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG 0: 1
1: 0
2: 1
3: 3
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039588669 Original CRISPR TCTGGGGACCCTCGCCGAAG AGG Intronic
900309006 1:2024545-2024567 CCTGGGGTCCCTCACCAAAGAGG - Intronic
900476531 1:2878843-2878865 TGTGGTCACCCTCGCTGAAGAGG - Intergenic
901207078 1:7503481-7503503 GCTGGCCACCTTCGCCGAAGGGG + Intronic
903810949 1:26034875-26034897 TCTGAGGACCCTGGCAGATGAGG + Exonic
903945400 1:26959710-26959732 CCTGGGGACCCTCGGAGGAGGGG - Intronic
904276134 1:29385510-29385532 TCTGGGGTCCCTGGGCCAAGAGG - Intergenic
905900631 1:41580164-41580186 TCTGGCAAACCTCACCGAAGAGG - Exonic
1075463085 10:122631733-122631755 CCTGGGGACCCTCGCCGAGGGGG + Intronic
1077457224 11:2688354-2688376 TCTGGGGAACTTCCCCGTAGAGG + Intronic
1081305773 11:41510278-41510300 CCTAGGGACCCTCGCGGGAGTGG + Intergenic
1084967309 11:72751496-72751518 TCTGGGGACTCTCCGCGAACAGG + Intronic
1088961366 11:114669141-114669163 TCTGTGGACCCTCTCCCCAGTGG + Intergenic
1089333296 11:117705021-117705043 TCTGCGTACCCACGCCGAGGGGG + Intronic
1089679469 11:120111244-120111266 TCTGGGGACCCTCAGGGAAATGG + Intergenic
1108704534 13:52973360-52973382 TCTGGGGACCCTTGCTGAATTGG + Intergenic
1113887145 13:113666991-113667013 TCTGGGGCCCCTGGCTGGAGAGG - Intergenic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1121647092 14:95525935-95525957 TCTGATGACCCTCTCCTAAGTGG + Intergenic
1132550168 16:550926-550948 ACAGGGGACCCTCACCGAAAGGG - Intronic
1132550271 16:551188-551210 ACTGGGGACCCTCACCGACCGGG - Intronic
1132713134 16:1278126-1278148 TCTGGGGCCCCTCCACCAAGAGG + Intergenic
1137268237 16:46885559-46885581 TCTGGGGACAGTCACCGAGGTGG + Intronic
1142008723 16:87702664-87702686 TCAGGGGAGCCACGCGGAAGAGG + Intronic
1142329889 16:89445070-89445092 CCTGGGCACCCTCACCCAAGGGG - Intronic
1143512294 17:7403582-7403604 TCTGGGGTCCCTGGGGGAAGTGG - Intronic
1146039044 17:29433785-29433807 TCTGGGGACCCTCTCCCACCTGG + Intronic
1152414058 17:80147498-80147520 TCTGGGGACCCCGCCCGGAGCGG - Intergenic
1153480653 18:5543576-5543598 CCTGGGATCCCTGGCCGAAGGGG - Intronic
1160686349 19:438685-438707 TCTGGGGACGCCAGGCGAAGAGG + Intronic
1160704166 19:521846-521868 TCTTGGGACCCTCCCCAAAGAGG - Intergenic
1161465858 19:4429976-4429998 TCTGGTGACACTCGCCCACGTGG + Intronic
1164146052 19:22513227-22513249 GCTGGGGAGCCTCGGGGAAGGGG - Intronic
1166233786 19:41441600-41441622 ACTGGGGACCCTTGCCTTAGAGG + Intergenic
1166750015 19:45160108-45160130 TCTGGGCATCCTTGGCGAAGTGG + Exonic
1166852306 19:45766674-45766696 CCTGGGGCCCCTGGCCCAAGTGG - Exonic
1167239437 19:48334330-48334352 TCTGGGGACCCGTACTGAAGAGG - Intronic
927784003 2:25959812-25959834 TCTGGGGAACCTGGCAGGAGGGG + Intronic
927911631 2:26903933-26903955 TCTCTGGACCCTCACGGAAGAGG - Intronic
929277478 2:40041807-40041829 TCTGGGGGCACTAGCTGAAGTGG - Intergenic
942045069 2:172095286-172095308 ACTGGGGACCCTCCCCAAAAGGG + Intergenic
947227910 2:227857808-227857830 TCTGGGGACCCTCTCCCACCTGG + Intergenic
1176287914 21:5028596-5028618 TCAGGGGACACACGCCCAAGAGG - Intronic
1179869267 21:44234879-44234901 TCAGGGGACACACGCCCAAGAGG + Intronic
949883833 3:8679584-8679606 TCTTGGGACCCCCATCGAAGGGG + Intronic
953974265 3:47370740-47370762 TCTAGGAACCCTTGCCTAAGCGG + Intergenic
971395358 4:26222038-26222060 TCTAGGGCCCCTCGTCAAAGTGG - Intronic
977642082 4:99368320-99368342 TCTGTGGACCCTTGCCAATGGGG + Intergenic
980988352 4:139717468-139717490 GCTGGGCGCCCTCTCCGAAGAGG - Exonic
985987987 5:3533420-3533442 TCTGGGGCCCCTCCCAGAGGCGG + Intergenic
986712972 5:10501341-10501363 TCCAGGGACCCTCACAGAAGAGG - Intergenic
998341065 5:141418508-141418530 GGTGGGGACCCTCCCCGAAGCGG + Exonic
1002440434 5:179261802-179261824 TCTGGGGTCCCTCCCCACAGTGG + Intronic
1002473435 5:179451052-179451074 TCCGGGGAACCTGGCGGAAGAGG - Intergenic
1006401856 6:33822369-33822391 ACTGGGGCTCCTCCCCGAAGAGG + Intergenic
1009475845 6:64091588-64091610 TCTGGGGACCATCAACGTAGAGG - Intronic
1018960098 6:168441659-168441681 TCTGGGGACCCTGCCCGCCGGGG + Intronic
1037922464 8:22817041-22817063 TTTGAGGACCCTCCCTGAAGAGG + Intronic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1042446486 8:68890771-68890793 TCTGTGGACCCTTGCCAATGAGG + Intergenic
1049090885 8:140512367-140512389 GCTGGGGCCCCTCGTCTAAGAGG + Intronic
1049936504 9:505185-505207 ACGGGGGACCCTCTCTGAAGCGG + Intronic
1052616647 9:30851139-30851161 TCTGGGGACCCTCTCCCACCTGG - Intergenic
1061987217 9:134136539-134136561 TCTGGGGTCCTTCCCTGAAGGGG - Intronic
1185465544 X:352377-352399 CCTGGGGGCCGTCGCCGTAGCGG - Intronic
1186301760 X:8206938-8206960 TCTGGGGACAGTGGCAGAAGAGG + Intergenic
1200393468 X:155968117-155968139 TCTGGGTCCCCTCTCCGTAGTGG - Intergenic