ID: 1039589584

View in Genome Browser
Species Human (GRCh38)
Location 8:38735400-38735422
Sequence CAGCCTCCCAGGCACAGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039589584_1039589597 29 Left 1039589584 8:38735400-38735422 CCCGCGCTGTGCCTGGGAGGCTG No data
Right 1039589597 8:38735452-38735474 CGGGTAGATTTAGCCAGAGGAGG No data
1039589584_1039589592 10 Left 1039589584 8:38735400-38735422 CCCGCGCTGTGCCTGGGAGGCTG No data
Right 1039589592 8:38735433-38735455 CACCCTTACATCTGGCTTCCGGG No data
1039589584_1039589595 26 Left 1039589584 8:38735400-38735422 CCCGCGCTGTGCCTGGGAGGCTG No data
Right 1039589595 8:38735449-38735471 TTCCGGGTAGATTTAGCCAGAGG No data
1039589584_1039589598 30 Left 1039589584 8:38735400-38735422 CCCGCGCTGTGCCTGGGAGGCTG No data
Right 1039589598 8:38735453-38735475 GGGTAGATTTAGCCAGAGGAGGG No data
1039589584_1039589590 2 Left 1039589584 8:38735400-38735422 CCCGCGCTGTGCCTGGGAGGCTG No data
Right 1039589590 8:38735425-38735447 CAGACTGGCACCCTTACATCTGG No data
1039589584_1039589591 9 Left 1039589584 8:38735400-38735422 CCCGCGCTGTGCCTGGGAGGCTG No data
Right 1039589591 8:38735432-38735454 GCACCCTTACATCTGGCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039589584 Original CRISPR CAGCCTCCCAGGCACAGCGC GGG (reversed) Intronic