ID: 1039590153

View in Genome Browser
Species Human (GRCh38)
Location 8:38739434-38739456
Sequence TGTATGTAAGCACTGACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039590153_1039590154 3 Left 1039590153 8:38739434-38739456 CCAGATGTCAGTGCTTACATACA 0: 1
1: 0
2: 0
3: 6
4: 152
Right 1039590154 8:38739460-38739482 TCTTTTGCCTTTCGTCTTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039590153 Original CRISPR TGTATGTAAGCACTGACATC TGG (reversed) Intronic
905298118 1:36967489-36967511 TCTATGGAAACACTGACACCAGG + Intronic
908420836 1:63957004-63957026 TGAATTTAAGCCCTGGCATCTGG + Intronic
910266007 1:85338531-85338553 TTCATGTAGGAACTGACATCTGG + Intronic
913944419 1:125144881-125144903 TGTATGCAAAGACTCACATCAGG - Intergenic
913954763 1:143278891-143278913 TGTATGCAAAGACTCACATCAGG + Intergenic
913982674 1:143536476-143536498 TGTATGCAAAGACTCACATCAGG - Intergenic
918189448 1:182158655-182158677 TATATGTGAGGACTGACTTCTGG + Intergenic
918663091 1:187113847-187113869 TGTATGTTATCACTGATATGCGG - Intergenic
918909947 1:190554819-190554841 TTTATGTAAGCAATGATATTTGG + Intergenic
919202567 1:194375171-194375193 TTTATGTAAGCACTACCATATGG - Intergenic
921465774 1:215485817-215485839 TATATGTCATCACTGACATCGGG - Intergenic
1063865570 10:10361810-10361832 TGTATGTGTACACTGACCTCAGG + Intergenic
1064208511 10:13345220-13345242 TCTATGTAAAATCTGACATCTGG + Intronic
1065261002 10:23923168-23923190 TGTATGTTCTCACTGACATGTGG - Intronic
1070271456 10:74960243-74960265 AGTATGTTAGTACTGACATATGG + Intronic
1071284348 10:84130426-84130448 TGTAATAAAGCACTGTCATCTGG - Intergenic
1071815755 10:89231347-89231369 TGTATGTGAGCAGTGCCTTCCGG - Intronic
1072317167 10:94214326-94214348 TGTATGTAATCACTCTCCTCAGG - Intronic
1073001235 10:100287532-100287554 TGTGTGTATGTACTGGCATCGGG - Intergenic
1078015223 11:7607575-7607597 TGTATCTAGGCACTGGCATCTGG + Intronic
1079918435 11:26400306-26400328 TGTAAGCTAGCACTGACATAAGG + Intronic
1082857224 11:57818897-57818919 TGTATATAAGTACTGACCACTGG + Exonic
1090559025 11:127909755-127909777 TGTATGTTATCACTGATATGTGG - Intergenic
1091988261 12:4931849-4931871 TGGATGTAAGCACTGCCACATGG - Intergenic
1100955824 12:99906994-99907016 TGTGTGTAAGCTCTGCCTTCAGG - Intronic
1105494040 13:20914811-20914833 TGTATGTAAGGACTCATTTCTGG - Intergenic
1106576179 13:30977845-30977867 TGTATGTGAGCACAGCCATGTGG + Intergenic
1108178481 13:47818621-47818643 TCTCTGTAAGCACAGTCATCGGG - Intergenic
1111979957 13:95004735-95004757 TGTATGCAAGTAAAGACATCCGG - Intergenic
1114720086 14:24872398-24872420 TGTATGTTATCACTGACTTCAGG - Intronic
1118374502 14:65165016-65165038 GGTTTGTCAGCACTGACAGCTGG - Intergenic
1118545386 14:66881417-66881439 TGTATACAAGCAATAACATCAGG + Intronic
1119412640 14:74443657-74443679 CATATGGAAGCACTTACATCAGG - Intergenic
1120073188 14:80126016-80126038 TGTATGTAGAAACTGACTTCAGG + Intergenic
1120595443 14:86428891-86428913 TTTGTGGAAGCACTGACAACTGG + Intergenic
1121630729 14:95420169-95420191 TGTATTTCAGCAGTGACTTCGGG + Intronic
1123971064 15:25508182-25508204 TGTTTGTAAACAATGCCATCAGG - Intergenic
1124411164 15:29438486-29438508 TCTATTTCAGCACTGACAACAGG - Intronic
1126389475 15:48131299-48131321 TGTATGTAATCACTCTAATCAGG + Intronic
1131781633 15:95865965-95865987 TGTATGAAGCCACTGACATGGGG + Intergenic
1132824790 16:1898867-1898889 TGCAGGAAGGCACTGACATCAGG - Intergenic
1135855873 16:26009606-26009628 TGGATGCAAGCACTGCCATGTGG + Intronic
1136708251 16:32209099-32209121 TGTTTGTAAGCACTAGCATGTGG - Intergenic
1136759657 16:32720310-32720332 TGTTTGTAAGCACTAGCATGTGG + Intergenic
1136808447 16:33150076-33150098 TGTTTGTAAGCACTAGCATGTGG - Intergenic
1141348018 16:83266306-83266328 TGGATTTAAGCACTGACATGAGG + Intronic
1203061811 16_KI270728v1_random:980618-980640 TGTTTGTAAGCACTAGCATGTGG + Intergenic
1147462653 17:40583310-40583332 TGTATGTTCTCACTGACATGTGG - Intergenic
1147747935 17:42707081-42707103 TGGATGTCAGCAGAGACATCCGG - Intronic
1148508450 17:48147146-48147168 TGTTTATAAGCACTGATATAGGG - Intronic
1157103003 18:44746888-44746910 AGTGTGTAAGCACTGTCTTCAGG + Intronic
1158061725 18:53351781-53351803 TGTCTGTAAACACTGACGTGAGG - Intronic
1158314630 18:56197657-56197679 TGTATTCAAGCACTGAAAGCAGG + Intergenic
1160210243 18:76871825-76871847 GGTATGAAAACACTGACTTCTGG + Exonic
1163892770 19:20031524-20031546 TGCATATAAGCACTGGCTTCTGG - Intronic
1168627373 19:57930020-57930042 TCTATGTAGGCAGTGACAACGGG + Intronic
925435096 2:3830169-3830191 GATATGTAAGCACAAACATCAGG - Intronic
927060706 2:19416806-19416828 TGTATGTCAGCAGTGCCCTCTGG + Intergenic
928954011 2:36842802-36842824 TCTAAGGAAGCACTGACATACGG - Intergenic
931069425 2:58627866-58627888 TGTATAAAACCACTGACATTGGG - Intergenic
936444753 2:112586648-112586670 AGCATGTAAGGACTGAAATCTGG + Intronic
937271668 2:120656816-120656838 TGTATGACAGAAATGACATCGGG + Intergenic
937638695 2:124187377-124187399 TGGATCTAACCACTGAAATCAGG - Intronic
941389952 2:164899705-164899727 TGTATGTATTCTATGACATCAGG - Intronic
942072275 2:172326740-172326762 GGTATATAAGCACTGACCTGTGG - Intergenic
945979105 2:216294872-216294894 TGTATGCAAGCATTGACTGCTGG + Intronic
946403289 2:219480119-219480141 TGTCTGGAGTCACTGACATCTGG + Exonic
947414967 2:229885485-229885507 TGCAAGCAAGAACTGACATCTGG + Intronic
948894841 2:240923283-240923305 TGTCAGTGAGCACTGACATTAGG + Intronic
1176698298 21:10008051-10008073 TGTATAGAAACACTGTCATCAGG - Intergenic
1181340628 22:22176913-22176935 CAAATCTAAGCACTGACATCAGG - Intergenic
1185362339 22:50415837-50415859 CGTATGTAAGCTCTGTCTTCAGG - Intronic
952624241 3:35384385-35384407 TCTATGTATGCACGGACATATGG + Intergenic
954495801 3:50959904-50959926 TGTATGAAATCACTTACATGTGG - Intronic
957698821 3:83682285-83682307 TGTATTCAAGCACTAGCATCTGG - Intergenic
959601694 3:108193967-108193989 GGTATGTGAGCCCTGACCTCAGG + Intronic
959604620 3:108228582-108228604 TGTATGTATGAAGTGACTTCAGG + Intergenic
959879248 3:111423907-111423929 TGTATGTTCTCACTGACATGTGG + Intronic
963580542 3:147121452-147121474 TGTTTGTAAACACAGACCTCTGG + Intergenic
965333135 3:167401970-167401992 TATAAGTAAGCAGTGAGATCTGG + Intergenic
966158942 3:176947986-176948008 TGCATTTAAAAACTGACATCTGG + Intergenic
967400248 3:189052849-189052871 TGTATGTTATCACTGATATGTGG + Intronic
970036542 4:11741870-11741892 TGTATGTAGGCACAGCCTTCAGG + Intergenic
970806561 4:20042638-20042660 ATTCTGTAAGTACTGACATCTGG + Intergenic
971120882 4:23703657-23703679 TGTACATCAGCACTGACACCAGG - Intergenic
973112464 4:46412800-46412822 TGGCTATAAGCACTGAAATCTGG + Intronic
975720332 4:77243049-77243071 TGCATGTATGCAGTGTCATCAGG + Intronic
977474396 4:97487011-97487033 TGTATGTTCTCACTGACATGTGG + Intronic
977688231 4:99873796-99873818 GGTAAGTAAGCACTGGCTTCAGG + Intergenic
978674655 4:111297537-111297559 TGTACTCTAGCACTGACATCTGG + Intergenic
979124704 4:116954175-116954197 AGCATGTTAGCACTGCCATCAGG - Intergenic
980370845 4:131867874-131867896 TGTATGGAAACACTGTCATCAGG - Intergenic
981206058 4:142041671-142041693 TCTATGTAAGAACTGAGATTTGG - Intronic
981351990 4:143741660-143741682 TATATGTAAGAACTGAGTTCTGG - Intergenic
981778658 4:148399832-148399854 TGTGTGTTAGCACTCATATCTGG - Intronic
983806975 4:172006043-172006065 AGTATTTAAGCAATGACAGCTGG - Intronic
984417904 4:179483959-179483981 TCTATTTCAGCACTGACAACAGG + Intergenic
984466634 4:180108234-180108256 TGTATGTAAGAAATAACAGCTGG - Intergenic
985973310 5:3394049-3394071 TGTTTGTAAACAGTGACATGTGG - Intergenic
988595149 5:32584262-32584284 TGAAAATAAACACTGACATCAGG - Intronic
990032593 5:51279952-51279974 TTTTTGTAAGCATTCACATCAGG - Intergenic
996229212 5:121040566-121040588 GGTATATAAGAAATGACATCAGG + Intergenic
996517219 5:124383899-124383921 TGTATGTATCCACTGTCTTCTGG - Intergenic
998327844 5:141297878-141297900 TGTATGTAAGTGCTGGCATTAGG + Intergenic
998979353 5:147684052-147684074 TGTAGGTGAGCACTGACCCCTGG - Intronic
999563419 5:152830178-152830200 TGGATATGAGCACTGTCATCAGG - Intergenic
1000353487 5:160371207-160371229 TGTATGTGCACACTCACATCCGG - Intergenic
1000992356 5:167924023-167924045 TCTTTGTCAGCACTGACAACTGG - Intronic
1002097877 5:176842620-176842642 TGTATGTCCCCACTGACATGTGG + Intronic
1004527912 6:16426539-16426561 TGTATGTAAGCAGAGCCACCTGG + Intronic
1007937312 6:45744258-45744280 TGTATGTAAGAAGTTATATCAGG - Intergenic
1009432054 6:63574563-63574585 TGTAAGTAAGCACTTTCATCAGG - Intronic
1011542210 6:88442990-88443012 TGTATGTAACTTCTGACATTGGG - Intergenic
1011820872 6:91252372-91252394 TGTATGTAGGCACTGAGGACTGG + Intergenic
1013566625 6:111371008-111371030 TGCATGTATGCACTGACCTGTGG - Intronic
1014638211 6:123875684-123875706 TGTCTCTAAGCACTGAAATATGG - Intronic
1014861673 6:126475734-126475756 TATATGTAAACATTGACATAGGG + Intergenic
1015461632 6:133498208-133498230 TGTTTGTTAGCACTGCCATTAGG - Intronic
1017744050 6:157431118-157431140 TGTAAGCCAGCACTTACATCAGG + Intronic
1018235092 6:161716236-161716258 TCTTTATCAGCACTGACATCTGG - Intronic
1024440620 7:49413225-49413247 TGTACATAAGCACTGTAATCTGG + Intergenic
1027351811 7:77319551-77319573 TATCTGTAAGAACTGAAATCAGG + Intronic
1030178502 7:106679616-106679638 TGTAAGTAACAGCTGACATCAGG - Intergenic
1036450519 8:8863231-8863253 GGAAAGTAAGCACTGAAATCAGG + Intronic
1037682402 8:21108395-21108417 TGAATGAGAGCACTGAGATCAGG + Intergenic
1038463511 8:27738029-27738051 TGTATGTTATCACTGATATGTGG + Intronic
1039590153 8:38739434-38739456 TGTATGTAAGCACTGACATCTGG - Intronic
1039676360 8:39672364-39672386 GGTAGGTAAGCACTGCTATCTGG - Intronic
1039836177 8:41258239-41258261 TATATTTAAGCCCTGACACCCGG + Intergenic
1044168687 8:89021962-89021984 TGTATGTTCTCACTGACATGTGG - Intergenic
1047332018 8:123898506-123898528 TGTATGTTCTCACTGACATGAGG - Intronic
1047761785 8:127959958-127959980 TGTATGTCTGCACTTACTTCTGG + Intergenic
1047900157 8:129412085-129412107 TGTATGTATACTCTGAAATCAGG + Intergenic
1049456962 8:142697853-142697875 TATATGTAAGGAATGACATTAGG + Intergenic
1052102445 9:24465193-24465215 TTTCTGTAAGCACTGGCATGAGG + Intergenic
1052354752 9:27493108-27493130 TGTATGTAAGAACATACATTTGG + Intronic
1054316351 9:63591839-63591861 TGTATAGAAACACTGTCATCAGG - Intergenic
1054807877 9:69410829-69410851 TATATGTAAAGATTGACATCTGG + Intergenic
1060026622 9:120177373-120177395 TGTATGTCAGCACTGGCTCCTGG - Intergenic
1060238835 9:121886067-121886089 TATATCTCAGCACTGACACCAGG + Intronic
1188171158 X:26928679-26928701 TGTGTGTGATCACTGACATTTGG - Intergenic
1188695186 X:33181463-33181485 TGTAGGTAATCACTGAGCTCAGG + Intronic
1191913277 X:66174235-66174257 TGTATGTTCTCACTGACATGTGG - Intronic
1194031184 X:88817677-88817699 TGTATGTTCTCACTGACATGTGG + Intergenic
1196112333 X:111960371-111960393 TTTGTATAACCACTGACATCTGG + Intronic
1196531198 X:116788761-116788783 TGTATGTTATCACTGATATGTGG + Intergenic
1198319821 X:135509674-135509696 TCTATGTAAGCACAGAGATAAGG + Intergenic
1199150101 X:144421698-144421720 TGTATGTTCTCACTGACATGTGG - Intergenic
1199489736 X:148385084-148385106 TGTATGTCAGCACTAACAATTGG - Intergenic
1200694197 Y:6343596-6343618 TGTAGCTAAGCAGTAACATCAGG - Intergenic
1200917550 Y:8584611-8584633 TGTATGAATGCCCTCACATCAGG - Intergenic
1200926983 Y:8663479-8663501 GGTATGTAAGCCCTCAAATCTGG - Intergenic
1200938889 Y:8762168-8762190 GGTATGAAAGCACTCAAATCAGG + Intergenic
1200939000 Y:8763164-8763186 GGTATGAAAGCACTCATATCAGG + Intergenic
1200961795 Y:9002611-9002633 GGTATGAAAGCTCTGACATTGGG - Intergenic
1201016663 Y:9610266-9610288 TGTAGCTAAGCAGTAACATCAGG + Intergenic
1201041080 Y:9831120-9831142 TGTAGCTAAGCAGTAACATCAGG + Intergenic
1202047595 Y:20750161-20750183 TGTATGATTACACTGACATCGGG + Intergenic
1202098888 Y:21284629-21284651 TGTATGTTATCACTCACTTCTGG - Intergenic