ID: 1039593589

View in Genome Browser
Species Human (GRCh38)
Location 8:38770765-38770787
Sequence ACCGAAGAGACTCCTGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 44}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039593589_1039593593 -6 Left 1039593589 8:38770765-38770787 CCAGCGCCAGGAGTCTCTTCGGT 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1039593593 8:38770782-38770804 TTCGGTATCCCTGAGAGTCGGGG No data
1039593589_1039593599 29 Left 1039593589 8:38770765-38770787 CCAGCGCCAGGAGTCTCTTCGGT 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1039593599 8:38770817-38770839 TGCGGCCCTTGATGGTGTTGTGG No data
1039593589_1039593598 21 Left 1039593589 8:38770765-38770787 CCAGCGCCAGGAGTCTCTTCGGT 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1039593598 8:38770809-38770831 TCTTTAAATGCGGCCCTTGATGG No data
1039593589_1039593591 -8 Left 1039593589 8:38770765-38770787 CCAGCGCCAGGAGTCTCTTCGGT 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1039593591 8:38770780-38770802 TCTTCGGTATCCCTGAGAGTCGG No data
1039593589_1039593592 -7 Left 1039593589 8:38770765-38770787 CCAGCGCCAGGAGTCTCTTCGGT 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1039593592 8:38770781-38770803 CTTCGGTATCCCTGAGAGTCGGG No data
1039593589_1039593597 11 Left 1039593589 8:38770765-38770787 CCAGCGCCAGGAGTCTCTTCGGT 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1039593597 8:38770799-38770821 TCGGGGGAACTCTTTAAATGCGG No data
1039593589_1039593594 -5 Left 1039593589 8:38770765-38770787 CCAGCGCCAGGAGTCTCTTCGGT 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1039593594 8:38770783-38770805 TCGGTATCCCTGAGAGTCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039593589 Original CRISPR ACCGAAGAGACTCCTGGCGC TGG (reversed) Intronic
902078278 1:13804265-13804287 ACCGCAGCGACTCCTTGGGCTGG + Intronic
911038734 1:93575658-93575680 ACCCAGGAGACTCCAGGTGCTGG + Intronic
911266735 1:95752940-95752962 ACCGCCGAGACTCGTGGGGCTGG + Intergenic
920736472 1:208537465-208537487 AACTAAGTGACTCCTGGTGCTGG - Intergenic
1073207773 10:101777628-101777650 ACTGAACAGACTCCTGGAGGAGG - Intronic
1076484021 10:130804276-130804298 AACGAAGAGAGTCCAGGCTCTGG - Intergenic
1078646128 11:13142615-13142637 ACAGAAGAGGCTCCTGGCTGGGG + Intergenic
1090511748 11:127383020-127383042 AAAGAAGAAACTCCTGTCGCTGG + Intergenic
1097850247 12:64404395-64404417 CTCCAAGAGACTGCTGGCGCCGG + Exonic
1102618290 12:114173707-114173729 ACTGAGGAGACTCATGGCTCTGG - Intergenic
1103916110 12:124376499-124376521 ACCCAAGGGACTCGTGGCCCAGG + Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118819483 14:69335737-69335759 AGCTATGAGACTCCTGTCGCTGG + Intronic
1125599889 15:40909729-40909751 TCCTATGAGACTCCTGGAGCTGG - Intergenic
1141642826 16:85351239-85351261 GCCGAAGAGGCTCCTGGAGAAGG + Intergenic
1142521462 17:507710-507732 ACAGAAGAGGCTGCTGGGGCCGG - Intergenic
1147772039 17:42874468-42874490 AGGGAAGAGAGTCCTGGCACAGG - Intergenic
1152044909 17:77929489-77929511 GGGGTAGAGACTCCTGGCGCTGG - Intergenic
1156290962 18:35748268-35748290 ACCGAGGAGACTCCAGGTGCAGG + Intergenic
1157338533 18:46758080-46758102 ACCGCAGAGGCTCCAAGCGCTGG + Intronic
1164708865 19:30340077-30340099 ACAGCAGACACTCCTGGAGCTGG - Intronic
1166967051 19:46535334-46535356 AGCGAAGTGGCTCCTGGAGCTGG + Intronic
925889182 2:8419992-8420014 ACAGAAGAGACTCCTGCAGCAGG + Intergenic
926249682 2:11147366-11147388 AAAGAAGAGAATCCTGGAGCTGG - Intergenic
937430774 2:121836192-121836214 ACTGGAGAGACCCCTGGGGCAGG - Intergenic
939085298 2:137711073-137711095 ACCGAAGTAAGTCCTGACGCAGG + Intergenic
947396468 2:229692040-229692062 AATGAAGAGACTCATGGCCCAGG + Intronic
947678595 2:232008577-232008599 ACCCAAGAGACTTCTGGGGATGG + Intronic
947773273 2:232687716-232687738 ACTGTAGAGACTCAGGGCGCAGG - Intergenic
948601298 2:239108869-239108891 ACAGAAGAGGCTCCTGGTGGGGG + Intronic
1175782334 20:61690556-61690578 ACTGAAGAGCCTCCTGGAGCAGG + Intronic
1176173782 20:63708224-63708246 ACAGAAGAGACGCCGGGCGGGGG + Intronic
1179165834 21:38934449-38934471 TCTGAAGAGACTTCTGGCCCTGG - Intergenic
952130542 3:30356759-30356781 ACCTCAGAGAGTCCTGGCACTGG + Intergenic
991684096 5:69166109-69166131 CCAATAGAGACTCCTGGCGCTGG - Intergenic
1002131452 5:177084453-177084475 ACAGATGAGGCTCCTGGCCCTGG - Intergenic
1002431940 5:179208834-179208856 TCCTCAGAGACTCCTGGCCCGGG + Intronic
1007886212 6:45233075-45233097 ACCTGAGAGACTCCTGTCTCAGG - Intronic
1023639507 7:42243165-42243187 ACCAAAGAGACTCCTAGCAAGGG + Intergenic
1026828414 7:73597439-73597461 AGCGGAGACACTCCTGGGGCAGG + Exonic
1027330983 7:77092414-77092436 ACCTAAGAGACTCCAGTGGCTGG + Intergenic
1029784790 7:102778915-102778937 ACCTAAGAGACTCCAGTGGCTGG - Intronic
1039593589 8:38770765-38770787 ACCGAAGAGACTCCTGGCGCTGG - Intronic
1042395403 8:68286036-68286058 AACAAAGAGGCTCCTGGGGCTGG + Intergenic
1044364833 8:91332637-91332659 ACTCAAGAGACTGCTGGCGGTGG - Intronic
1047951725 8:129940355-129940377 ACAGTACAGTCTCCTGGCGCTGG - Intronic
1056958563 9:91101926-91101948 ACTGAAGAGACTGCTGGAGAAGG + Intergenic
1061496408 9:130977367-130977389 ACCTAAGAGGCTACTGCCGCGGG - Intergenic
1061906693 9:133702799-133702821 CCCGAAGAGACTCCTGGGGGAGG + Intronic