ID: 1039594360

View in Genome Browser
Species Human (GRCh38)
Location 8:38777949-38777971
Sequence TTCTTTTGCTAGAAGAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039594356_1039594360 19 Left 1039594356 8:38777907-38777929 CCTCTTGCTGTGTGACCATGTGC 0: 1
1: 1
2: 11
3: 129
4: 666
Right 1039594360 8:38777949-38777971 TTCTTTTGCTAGAAGAAATAAGG No data
1039594357_1039594360 4 Left 1039594357 8:38777922-38777944 CCATGTGCTCAGCAAAAATTCAG 0: 1
1: 2
2: 4
3: 38
4: 314
Right 1039594360 8:38777949-38777971 TTCTTTTGCTAGAAGAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039594360 Original CRISPR TTCTTTTGCTAGAAGAAATA AGG Intronic
No off target data available for this crispr