ID: 1039595005

View in Genome Browser
Species Human (GRCh38)
Location 8:38784119-38784141
Sequence GCTTCGTTCTTACCTGGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 54}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039595005_1039595011 9 Left 1039595005 8:38784119-38784141 CCTGTACCAGGTAAGAACGAAGC 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1039595011 8:38784151-38784173 GAGCAGCAGACTGAGAGGAGTGG No data
1039595005_1039595010 4 Left 1039595005 8:38784119-38784141 CCTGTACCAGGTAAGAACGAAGC 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1039595010 8:38784146-38784168 ACTAGGAGCAGCAGACTGAGAGG No data
1039595005_1039595012 21 Left 1039595005 8:38784119-38784141 CCTGTACCAGGTAAGAACGAAGC 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1039595012 8:38784163-38784185 GAGAGGAGTGGTCCAGCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039595005 Original CRISPR GCTTCGTTCTTACCTGGTAC AGG (reversed) Intronic
907178817 1:52552755-52552777 ACTTCTTTCTTTCCTGGAACGGG - Intronic
917670678 1:177270637-177270659 GCTTCCTTCTTTCCTGGACCTGG + Intronic
920407573 1:205729335-205729357 GCTTTTTTCTTACCTGGTTTTGG - Intronic
921347952 1:214206597-214206619 GCTTCCTTCATAGTTGGTACAGG + Intergenic
1062841153 10:673036-673058 CCTTGGTTCTAACCAGGTACAGG - Intronic
1067567192 10:47347953-47347975 GCTTCCTACTTACTGGGTACTGG + Intergenic
1075654441 10:124152067-124152089 GCCTCTTTCTTGCCTGGTTCTGG - Intergenic
1077177746 11:1198296-1198318 CCGTGGCTCTTACCTGGTACAGG - Intronic
1080581940 11:33651491-33651513 GCCTCCTTCTTCCCTGGGACAGG + Intronic
1080854128 11:36097057-36097079 GCTTTGTGCTGACCTTGTACTGG + Intronic
1090704680 11:129325613-129325635 GCATCGTTTTAACCTGGAACTGG - Intergenic
1092382931 12:8012584-8012606 GCTTCCTTCTTGGTTGGTACAGG + Intergenic
1092514295 12:9192499-9192521 GCCTCATTCTTACCAGGTAATGG + Exonic
1095612291 12:44144572-44144594 GATTGCTTCTTACCTGGAACAGG + Intronic
1103991830 12:124804582-124804604 GCTTCATTCTTTGCTGGTATCGG - Intronic
1104628445 12:130379199-130379221 ACTTCATTTGTACCTGGTACTGG + Intergenic
1111795198 13:92910540-92910562 CCTTGGTTCTTACCTGGACCTGG - Intergenic
1113859013 13:113468945-113468967 GGCTCGTCCTTACCTGGTCCCGG - Intronic
1119383412 14:74242386-74242408 GCTTCGTTCTTCCTTGGCCCTGG + Intronic
1124247486 15:28083514-28083536 ACTTTGTTCTTACCAGGTAGTGG - Intronic
1125630258 15:41141567-41141589 GGTTAGTTCTTACCTCTTACAGG - Intergenic
1143897046 17:10144478-10144500 GATCCTTTCTTACCTGATACTGG - Intronic
1146082302 17:29791411-29791433 TCTTCTTTGTTACCTGGAACTGG + Intronic
1151713226 17:75818406-75818428 GCTTCTCTCTTCCCTGCTACAGG + Intronic
1153146509 18:2039012-2039034 CCTTCTATCTTACCTGGCACTGG - Intergenic
1153364922 18:4245098-4245120 GCTACGTTGTTAGCTGCTACTGG + Intronic
1159995225 18:74957939-74957961 GCTTCCTTGTTACCTGGCAGAGG + Intronic
1166338797 19:42124934-42124956 GATCCTTTCTTACCTGGTGCAGG - Intronic
928319887 2:30274592-30274614 GCTTCATTTTGACCTGGGACAGG - Intronic
932306065 2:70705063-70705085 GCTTCCTTCTTCCCTTTTACAGG - Intronic
934044359 2:88160157-88160179 CCTTCTTTCCTACATGGTACTGG - Intergenic
939403348 2:141724050-141724072 TTTTCTTTCTTATCTGGTACAGG - Intronic
946099682 2:217309255-217309277 GCCTGGTTCCTAACTGGTACTGG + Intronic
1169892906 20:10472802-10472824 CCTTCTTTGTTACCTGATACAGG + Intronic
1174298639 20:49567132-49567154 GCTTCGGTCTTACCTATAACAGG + Intronic
1175663993 20:60842962-60842984 ATTTTGTTCTTACTTGGTACTGG + Intergenic
955784159 3:62518668-62518690 GCTTCTTCCTTACCTGGGACAGG + Intronic
956163667 3:66380487-66380509 GGTTCGTTCTTTCCTTGTAGGGG - Exonic
961259808 3:125593168-125593190 GCTTCGTCCTGACCTGCTATGGG - Intronic
968754178 4:2406530-2406552 GCGCCGTGCTTACCTGATACAGG + Intronic
977902664 4:102440136-102440158 GCTTCTTTCTTACCAGATAAAGG - Intergenic
987382624 5:17299913-17299935 GTTTCCTTCTTACCTGGGAATGG + Intergenic
992107366 5:73461011-73461033 TCCTCCTTCTTACCTGGGACTGG + Intergenic
992414839 5:76542424-76542446 GCTTCGTTCCTTACCGGTACCGG + Intronic
999477067 5:151910202-151910224 CTTTCTTTCCTACCTGGTACAGG + Intronic
1004202488 6:13562186-13562208 GCTCCATTCCTACCTGGTCCGGG + Intergenic
1012718731 6:102712558-102712580 GCTTCAGTGTTACATGGTACAGG + Intergenic
1019865238 7:3702551-3702573 GCTTCATTCATACCTGCTTCTGG + Intronic
1024993085 7:55251542-55251564 CCTTCCTTCTTAACTAGTACAGG - Intronic
1034746600 7:153528903-153528925 GCTTAGTACTTACTTGTTACAGG + Intergenic
1037345178 8:17891096-17891118 TCTTCGTGCTTACATTGTACAGG - Intronic
1038400355 8:27279816-27279838 GCTTCTGTCTTCCCTGGTACTGG + Intergenic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1056535936 9:87527724-87527746 GCTTCTTTCTGAACTGTTACTGG + Intronic
1195024354 X:100861342-100861364 GCTTAGTTCTCATCTGGAACAGG - Intronic
1197096414 X:122601602-122601624 GCTGTGTTCTTATCTGGTATTGG - Intergenic