ID: 1039595010

View in Genome Browser
Species Human (GRCh38)
Location 8:38784146-38784168
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039595007_1039595010 -2 Left 1039595007 8:38784125-38784147 CCAGGTAAGAACGAAGCCAGGAC 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1039595010 8:38784146-38784168 ACTAGGAGCAGCAGACTGAGAGG No data
1039595005_1039595010 4 Left 1039595005 8:38784119-38784141 CCTGTACCAGGTAAGAACGAAGC 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1039595010 8:38784146-38784168 ACTAGGAGCAGCAGACTGAGAGG No data
1039595003_1039595010 23 Left 1039595003 8:38784100-38784122 CCTAGTTGTGACTTTGCAACCTG 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1039595010 8:38784146-38784168 ACTAGGAGCAGCAGACTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr