ID: 1039595508

View in Genome Browser
Species Human (GRCh38)
Location 8:38787298-38787320
Sequence GCCCGTCCTGTGGCCTCCTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 269}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039595508_1039595512 1 Left 1039595508 8:38787298-38787320 CCTGAGGAGGCCACAGGACGGGC 0: 1
1: 0
2: 2
3: 19
4: 269
Right 1039595512 8:38787322-38787344 TCTTCCCGGCTAGTGGAGCCCGG 0: 1
1: 0
2: 0
3: 7
4: 76
1039595508_1039595516 7 Left 1039595508 8:38787298-38787320 CCTGAGGAGGCCACAGGACGGGC 0: 1
1: 0
2: 2
3: 19
4: 269
Right 1039595516 8:38787328-38787350 CGGCTAGTGGAGCCCGGCGCGGG 0: 1
1: 0
2: 0
3: 7
4: 73
1039595508_1039595511 -6 Left 1039595508 8:38787298-38787320 CCTGAGGAGGCCACAGGACGGGC 0: 1
1: 0
2: 2
3: 19
4: 269
Right 1039595511 8:38787315-38787337 ACGGGCGTCTTCCCGGCTAGTGG 0: 1
1: 0
2: 0
3: 0
4: 65
1039595508_1039595517 8 Left 1039595508 8:38787298-38787320 CCTGAGGAGGCCACAGGACGGGC 0: 1
1: 0
2: 2
3: 19
4: 269
Right 1039595517 8:38787329-38787351 GGCTAGTGGAGCCCGGCGCGGGG 0: 1
1: 0
2: 0
3: 6
4: 79
1039595508_1039595515 6 Left 1039595508 8:38787298-38787320 CCTGAGGAGGCCACAGGACGGGC 0: 1
1: 0
2: 2
3: 19
4: 269
Right 1039595515 8:38787327-38787349 CCGGCTAGTGGAGCCCGGCGCGG 0: 1
1: 0
2: 1
3: 5
4: 63
1039595508_1039595518 18 Left 1039595508 8:38787298-38787320 CCTGAGGAGGCCACAGGACGGGC 0: 1
1: 0
2: 2
3: 19
4: 269
Right 1039595518 8:38787339-38787361 GCCCGGCGCGGGGCCCGCTGCGG 0: 1
1: 1
2: 4
3: 38
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039595508 Original CRISPR GCCCGTCCTGTGGCCTCCTC AGG (reversed) Exonic
900138919 1:1130915-1130937 GCCCGCCCTGTGCCCTTCACAGG - Intergenic
900142997 1:1146293-1146315 CGCCTTCCTGTGGCCACCTCTGG + Intergenic
901201976 1:7472217-7472239 CCCTGTCCTGTGGTCTCCTAAGG - Intronic
901236609 1:7670665-7670687 GCCGGTCCTGGGGCTTCCTGAGG + Intronic
901290587 1:8121158-8121180 GCCCAGCCCGTGGGCTCCTCAGG + Intergenic
902596967 1:17516312-17516334 GCCCCTCCTTTGCCCTCCTCGGG + Intergenic
903213302 1:21830258-21830280 GTCCTCCCTGTGGCCTCTTCTGG - Intronic
904077985 1:27854384-27854406 GCCCGGCCAGTGGCCCCGTCCGG + Intergenic
904369548 1:30039948-30039970 GTACATCCTGTGGTCTCCTCAGG - Intergenic
905276481 1:36821775-36821797 GCTCTTCCAGTGGCCCCCTCTGG - Intronic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
907410919 1:54282673-54282695 GTCAGACCTGTGGCTTCCTCAGG - Intronic
908920368 1:69183842-69183864 GCTTGTTCTGTGGACTCCTCTGG + Intergenic
913209605 1:116571472-116571494 GCCCGTCCTGCTGCCTCCTCCGG - Intergenic
913957305 1:143318152-143318174 GCCCTGCCTTTGGCCTGCTCTGG - Intergenic
914051619 1:144143516-144143538 GCCCTGCCTTTGGCCTGCTCTGG - Intergenic
914127578 1:144823025-144823047 GCCCTGCCTTTGGCCTGCTCTGG + Intergenic
915080384 1:153348070-153348092 TACCATCCTGTGGCCTCCTGAGG + Intronic
916245339 1:162682086-162682108 GCCTGTCCTGTGTCCTGCCCGGG + Intronic
917195903 1:172465547-172465569 GCACCACCTGTGCCCTCCTCAGG + Intronic
917375677 1:174349328-174349350 GCCCGGCCAGTGGCCCCATCCGG - Intronic
917375776 1:174349555-174349577 GCCCGGCCAGTGGCCCCGTCCGG - Intronic
918033949 1:180846951-180846973 TCCTCTCCTGTGGGCTCCTCAGG + Intronic
920827895 1:209438742-209438764 TACCCTCCTGTGGCCTTCTCTGG - Intergenic
921180680 1:212629232-212629254 GCCTGTCCTTTGTCCTCCACTGG - Intergenic
924847840 1:247790821-247790843 GCCCTCCCTGGAGCCTCCTCAGG + Intergenic
1063191332 10:3697444-3697466 GCCCGTGCTTTCTCCTCCTCTGG + Intergenic
1063449914 10:6144637-6144659 GCCTGTCTTGTGGACTCCACGGG - Intergenic
1066642255 10:37566445-37566467 GCCATTTCAGTGGCCTCCTCTGG - Intergenic
1067251144 10:44587943-44587965 GCCCTCCCTGGGCCCTCCTCAGG + Intergenic
1067569564 10:47361432-47361454 GCCCGGCCTGGGGGCTACTCTGG + Intergenic
1069090741 10:64196750-64196772 GCCAGTCCTGTGCCCTGCGCCGG + Intergenic
1069741062 10:70687157-70687179 GCCCGGCCAGTGGCCCCGTCCGG - Intronic
1071567116 10:86677047-86677069 GCCAGTCCTCTGGGCTTCTCTGG - Intronic
1071618348 10:87095458-87095480 GCCTGTCCTCTGGCGGCCTCAGG + Intronic
1072375622 10:94813189-94813211 TGCTGTTCTGTGGCCTCCTCTGG - Intronic
1072389490 10:94968836-94968858 TGCTGTTCTGTGGCCTCCTCTGG - Intronic
1072648710 10:97276718-97276740 GCCCGGCCAGTGGCCCCGTCCGG + Intronic
1073293734 10:102425801-102425823 GCCAGATCTGTGGGCTCCTCAGG - Intronic
1075738171 10:124676900-124676922 GCCTGTTCTGAGGCCTGCTCAGG + Intronic
1076042069 10:127258930-127258952 ACCTTTCCTTTGGCCTCCTCTGG + Intronic
1076327292 10:129635381-129635403 GCCCTTCCTGTGTGCCCCTCCGG + Intronic
1076667762 10:132102733-132102755 GCCCGTCCTGCCACCTCCGCTGG + Intergenic
1076725997 10:132413635-132413657 GGCCTTCCTGTGGCCGCATCTGG + Intronic
1076864459 10:133160175-133160197 GCCAGGCGTGTGGCCTCCGCGGG - Intergenic
1077154956 11:1087139-1087161 CTCCCTCCTCTGGCCTCCTCTGG + Intergenic
1077154975 11:1087193-1087215 CTCCCTCCTCTGGCCTCCTCTGG + Intergenic
1077219234 11:1408092-1408114 GCCCATCCTCTGGCCTCCCTGGG + Intronic
1078886529 11:15505944-15505966 GCCTGTCCTGAGGGCTCCTAGGG - Intergenic
1081634083 11:44709165-44709187 GCCAGTCCTGCTGCATCCTCTGG - Intergenic
1081831408 11:46119601-46119623 AACCGGCCTGTGGCCTTCTCCGG + Intronic
1081991949 11:47342764-47342786 GCAAGTGCTGTGGCCTCTTCTGG + Intronic
1082101815 11:48179066-48179088 GGCCATCCTGTGGCCTTCACTGG + Intergenic
1083382652 11:62279546-62279568 GCCCGGCCAGTGGCCCCGTCCGG + Intergenic
1083645754 11:64171623-64171645 GCCCGGCCAGTGGCCCCGTCCGG - Intergenic
1084352698 11:68614766-68614788 GACTGTCCTTGGGCCTCCTCTGG + Exonic
1084541212 11:69788288-69788310 CCCCATCCTGTGGGCCCCTCAGG - Intergenic
1088746395 11:112808239-112808261 GCCCACCCTATGGCCTCCCCAGG + Intergenic
1089196959 11:116699504-116699526 GGGAGTCCTGTGGCCTCATCAGG - Intergenic
1089198724 11:116710666-116710688 GCCCAGCCCTTGGCCTCCTCAGG - Intergenic
1089572868 11:119422030-119422052 GCCCCTTCTGTGGCCTCTCCTGG - Intronic
1091225191 11:133952949-133952971 CCACATCCTGTGGCCTTCTCAGG - Intronic
1096216187 12:49798629-49798651 GCCTGTGCTGTGGTCTCCTGAGG - Intronic
1096744241 12:53715154-53715176 TCCTGTCCTATGGCCTCCTGAGG - Intronic
1097078145 12:56410390-56410412 GGCCATCCTGTGCCCTGCTCTGG + Intergenic
1100560363 12:95742633-95742655 GGCCGTCCTGTGGACTCCCTTGG + Intronic
1100582438 12:95948380-95948402 GCCCGGCCAGTGGCCCCGTCCGG + Intronic
1101772115 12:107761101-107761123 TCCCGGCCCGCGGCCTCCTCTGG + Exonic
1101991038 12:109485305-109485327 GCCCGTCCTGTTTCCTCCCAAGG - Intronic
1102962628 12:117102495-117102517 GCCCGGGCTCTGCCCTCCTCTGG + Intergenic
1104047709 12:125174714-125174736 TCCCCTCCAGTGGCCTCCCCAGG + Intergenic
1104728707 12:131093503-131093525 GCCCGCCCTGTGCCCTTCCCTGG - Intronic
1104797501 12:131529724-131529746 GCCCTTCCTGTGGCCTGCGGAGG - Intergenic
1106376663 13:29195653-29195675 GCCCTTCCCTTGGCCTCCACAGG - Intronic
1108088304 13:46818526-46818548 GCCCATCCTCTGCCCTGCTCTGG - Intergenic
1108181602 13:47845782-47845804 GCCCGCCCTGTGGCCTTTTTTGG - Intergenic
1109883923 13:68517588-68517610 GCCTGGCATGTGGCCACCTCAGG + Intergenic
1110008219 13:70297809-70297831 GGCCGTCCTCTGTCCTGCTCTGG - Intergenic
1110624500 13:77637651-77637673 GGCAGTCCTGGGGCCTCCTGGGG - Intronic
1113739275 13:112700315-112700337 GTCCGTGCTGTGGGCACCTCCGG + Intronic
1120204632 14:81574448-81574470 GCACGTCCATTGGCCACCTCTGG + Intergenic
1120745525 14:88147587-88147609 GGCCATCCTGTGCCCTACTCTGG - Intergenic
1122104476 14:99441734-99441756 GCCCCTGCTGTGGCCTCATCAGG - Intronic
1123421367 15:20139785-20139807 GCCCTGCCTTTGGCCTGCTCTGG - Intergenic
1123530593 15:21146325-21146347 GCCCTGCCTTTGGCCTGCTCTGG - Intergenic
1123710008 15:22980242-22980264 GCCTGCCCTGCGGCCTCCGCGGG - Intronic
1124186059 15:27530627-27530649 GCCCTGCCTGTGGCCTCCAAGGG + Intronic
1124650213 15:31468934-31468956 GACCGTCCTCTGTCCTGCTCTGG + Intergenic
1125163892 15:36679892-36679914 GCTCTTCCTGTGGTCTCCACTGG - Intronic
1125865426 15:43043469-43043491 GCCTGTCCTGTGGCCTAGGCTGG + Intronic
1128533405 15:68470741-68470763 CCCCGACCTTAGGCCTCCTCTGG - Intergenic
1128547889 15:68579684-68579706 TCCCCTCCGCTGGCCTCCTCGGG - Intronic
1130607491 15:85331190-85331212 GCAAGTCCTGCTGCCTCCTCAGG + Intergenic
1130664571 15:85858976-85858998 ACTCCTCCTGCGGCCTCCTCGGG + Intergenic
1132030968 15:98438286-98438308 GCCCCTCCTGTGGCCTGATGAGG - Exonic
1132782147 16:1633196-1633218 GCCATTCCTGTGGTGTCCTCTGG + Intronic
1132875535 16:2135429-2135451 GCCCGTCCCGCGGCCTCTCCCGG + Intronic
1133230686 16:4365102-4365124 GCCAGTCCTGGGCCCTCCCCAGG - Intronic
1134406071 16:13959735-13959757 TCCTGTCCTGTGGCCGCCTGGGG - Intergenic
1134519452 16:14911931-14911953 GCCCGTCCCGCGGCCTCTCCCGG - Intronic
1134554484 16:15154304-15154326 GCCCGTCCCGCGGCCTCTCCCGG + Intergenic
1134707122 16:16310586-16310608 GCCCGTCCCGCGGCCTCTCCCGG - Intergenic
1134960418 16:18401538-18401560 GCCCGTCCCGCGGCCTCTCCCGG + Intergenic
1135145024 16:19953733-19953755 GCCCGTTCTGTGGCCTAGGCTGG + Intergenic
1135414276 16:22257067-22257089 GCAGGTCCTGTGGCCACCTTAGG - Intronic
1135972661 16:27083951-27083973 GCCCGTCCTGTGTCGGCTTCCGG + Intergenic
1137289489 16:47042167-47042189 CCCGGCCCTGTGGCCTCCACAGG + Intergenic
1138674076 16:58638415-58638437 ACCAGTCCTGTGGCCCCATCTGG + Intergenic
1139789057 16:69417626-69417648 GCCCGTTAGGTGGCCTCTTCTGG - Intergenic
1139968629 16:70759923-70759945 GCAGGTCATGTGACCTCCTCAGG + Intronic
1141484233 16:84328248-84328270 GCCTCACCTGCGGCCTCCTCTGG - Intronic
1141609183 16:85171427-85171449 GCCAGGCCTGTGGACTCCACCGG + Exonic
1141900427 16:86987153-86987175 GCCCTTCCTGGGGGCTTCTCTGG - Intergenic
1142011268 16:87715507-87715529 TTTCGTCCTGTCGCCTCCTCAGG + Intronic
1142128301 16:88420988-88421010 GCCCCTCCTGGGGCCTCTGCTGG - Intergenic
1142569556 17:864192-864214 GCCCATCCTGTGCCCTTCACCGG - Intronic
1142591082 17:1006395-1006417 GGCCGGACTGTGGCCGCCTCAGG - Intronic
1143611854 17:8022479-8022501 GCATGTCCTCTGGCCTTCTCTGG - Intergenic
1143868894 17:9943780-9943802 GCCTGTCCTGTTCTCTCCTCCGG - Intronic
1146399603 17:32492868-32492890 GCTTGTCCTGTGGCCTCAGCTGG + Exonic
1151827114 17:76529751-76529773 GCCCTGCCAGTGCCCTCCTCTGG + Intronic
1152764345 17:82127950-82127972 GGGAGTCCTGTGGCTTCCTCTGG - Intronic
1152788335 17:82263937-82263959 TTCATTCCTGTGGCCTCCTCTGG + Intronic
1153926882 18:9842331-9842353 GACCATCCTGTGGCCTCTTCAGG - Intronic
1154265302 18:12874424-12874446 GCCCGGCCTGCCGCCTCGTCCGG + Intronic
1158150168 18:54358348-54358370 CCCCTTCCTGTCGCCGCCTCAGG - Intronic
1160567772 18:79797956-79797978 ACCCGGCCGGCGGCCTCCTCGGG - Intergenic
1160912497 19:1481406-1481428 GCTCAGTCTGTGGCCTCCTCTGG - Exonic
1160983554 19:1827449-1827471 GCCACTCCTGTGGCCACCTCAGG - Exonic
1160996649 19:1885204-1885226 GCCCCTGCTCTGGGCTCCTCGGG + Intronic
1163122027 19:15223846-15223868 GCCCGTCTTCTCGCCTCCCCGGG + Intergenic
1163163640 19:15480459-15480481 GCCACCCCTGGGGCCTCCTCAGG + Intronic
1163484387 19:17577375-17577397 GCCGGTCCTGCCGCCGCCTCAGG - Exonic
1165015789 19:32879128-32879150 GCCCGTGGTGTAGCCTCCTCTGG - Exonic
1166028221 19:40107959-40107981 GCCCGGCCAGTGGCCCCGTCCGG - Intergenic
1166148369 19:40852439-40852461 GCCTGTCCTGTGGCCATCTGGGG - Intronic
1166152511 19:40884224-40884246 GCCTGTCCTGTGGCCATCTGGGG - Intronic
1166171383 19:41029748-41029770 GCCTGTCCTGTGGCCATCTGGGG - Intergenic
1166560801 19:43731341-43731363 GCCCGTCCTGTGTCCTCCACAGG - Exonic
1166879598 19:45919727-45919749 GCCCGTCGTGGTGCCTCCCCAGG - Intergenic
1167034923 19:46989422-46989444 GCCAGTCCTGAGGCCGTCTCTGG + Intronic
1167383226 19:49150289-49150311 GCCCGGACTGTGGCCTCGCCGGG + Exonic
1168145218 19:54416525-54416547 ACCCGTCCTGGGGCCACATCGGG - Intronic
1168687829 19:58358943-58358965 GCCAGGGCAGTGGCCTCCTCAGG + Intronic
1202691016 1_KI270712v1_random:95940-95962 GCCCTGCCTTTGGCCTGCTCTGG - Intergenic
924982336 2:235444-235466 GCCCATGCTGTTGCCTCCCCTGG - Intronic
924982343 2:235466-235488 GCCCGTGCTGCTGCCTCCCCTGG - Intronic
924982370 2:235545-235567 GCCCATGCTGTTGCCTCCCCTGG - Intronic
924982377 2:235567-235589 GCCCGTGCTGCTGCCTCCCCTGG - Intronic
924982404 2:235649-235671 GCCCGTGCTGCTGCCTCCCCTGG - Intronic
924982464 2:235832-235854 GCCCGTGCTGCTGCCTCCCCTGG - Intronic
924982490 2:235917-235939 GCCCGTGCTGCTGCCTCCCCTGG - Intronic
924982570 2:236163-236185 GCCCGTGCTGCTGCCTCCCCTGG - Intronic
926063932 2:9822231-9822253 GCCCGGCCTGTGCCCTGCCCTGG - Intergenic
926436990 2:12848441-12848463 GCAGTTCCAGTGGCCTCCTCTGG + Intergenic
926688823 2:15718635-15718657 GCCCATCCTGTGGCCACCTGGGG + Intronic
927683931 2:25158106-25158128 GCCAGACCTCTGGGCTCCTCTGG + Exonic
928436340 2:31257055-31257077 GCCCCTCCTGTGGCCTGCACTGG + Intronic
929379756 2:41335973-41335995 GCCCGTCCTGTGCCATGCGCTGG - Intergenic
930201523 2:48555420-48555442 GCCCGGCCAGTGGCCCCGTCCGG - Intronic
930279084 2:49348580-49348602 GCCCGCCCCATGGCCTTCTCAGG - Intergenic
931656062 2:64511820-64511842 GCCCGGCCAGTGGCCCCGTCCGG - Intergenic
932425490 2:71631803-71631825 GGCATTCCTGTGGTCTCCTCGGG + Intronic
933955378 2:87358011-87358033 GCCCTGCCTTTGGCCTGCTCTGG + Intergenic
934239564 2:90254222-90254244 GCCCTGCCTTTGGCCTGCTCTGG + Intergenic
934273629 2:91562519-91562541 GCCCTGCCTTTGGCCTGCTCTGG - Intergenic
934462003 2:94217562-94217584 GCCCTGCCTTTGGCCTGCTCTGG + Intergenic
934663367 2:96154650-96154672 TCCCCTCCCTTGGCCTCCTCTGG - Intergenic
935172513 2:100621419-100621441 GGCCGTCCTCCTGCCTCCTCAGG + Intergenic
936457142 2:112683673-112683695 GCCCTTGCTGTGGGCTCCTCGGG + Intergenic
937251361 2:120525920-120525942 GCCCGTGCTGAGCCCTGCTCTGG - Intergenic
937985804 2:127637586-127637608 GCCCGTCTTTTGGCCTCCCTGGG - Exonic
941025294 2:160449947-160449969 GGGAGTCCTGTGGCCTCATCAGG - Intronic
946220457 2:218221507-218221529 ACCTGTCCTGTGGCCTACTTGGG + Intronic
947624035 2:231608313-231608335 GCCCCTCCTGTGCCTTCCCCCGG + Intergenic
947828425 2:233122242-233122264 TCCCTACCTGTGTCCTCCTCAGG - Exonic
948425817 2:237886082-237886104 GCCACTCCTGTGGCCTGCGCAGG + Intronic
948847144 2:240688492-240688514 ACCTGTCCTGTGCACTCCTCTGG - Intergenic
1169220563 20:3820156-3820178 GCCCGTCCCGGAGCCTCCTAAGG + Intergenic
1172279659 20:33700100-33700122 GCCCGGCCAGTCGCCTCGTCCGG + Intergenic
1175366828 20:58461473-58461495 GCCCGTGCTGCCGCCCCCTCTGG - Exonic
1176070701 20:63224798-63224820 GCCCGTGGTGGGGCCTGCTCTGG + Intergenic
1176348391 21:5770908-5770930 GCCCGGCCAGCCGCCTCCTCCGG - Intergenic
1176355205 21:5891492-5891514 GCCCGGCCAGCCGCCTCCTCCGG - Intergenic
1176496436 21:7553547-7553569 GCCCGGCCAGCCGCCTCCTCCGG + Intergenic
1176542712 21:8168978-8169000 GCCCGGCCAGCCGCCTCCTCCGG - Intergenic
1176561663 21:8352023-8352045 GCCCGGCCAGCCGCCTCCTCCGG - Intergenic
1180740318 22:18049011-18049033 GCCAGTGCTGAGGCCCCCTCAGG - Intergenic
1182956817 22:34434406-34434428 GGCTGTCCTGTGGCTTTCTCTGG + Intergenic
1183161240 22:36114735-36114757 GCCTGTCTGTTGGCCTCCTCTGG - Intergenic
1183307727 22:37091799-37091821 CCCTGTCCTATGACCTCCTCTGG + Intronic
1183353478 22:37346266-37346288 GCCCTTCCTGGGGCCTGGTCTGG - Intergenic
1183421758 22:37715828-37715850 GCCCCTCCCGAGGCCTCCTCGGG - Exonic
1183522308 22:38302768-38302790 GCCCATCCTCTGGCATCCTCTGG + Intronic
1183929252 22:41226772-41226794 GCCTGTCCTGAGGCCACCGCAGG - Intronic
1184658900 22:45956287-45956309 GCCCGTGCTGTGGACGCCACAGG - Intronic
1184712846 22:46263194-46263216 GGGCGCCCGGTGGCCTCCTCAGG - Exonic
1185389356 22:50550408-50550430 GCCTGTCCTAAGGCCTCCCCAGG + Exonic
1203247579 22_KI270733v1_random:85221-85243 GCCCGGCCAGCCGCCTCCTCCGG - Intergenic
950153192 3:10704015-10704037 GCCTTTACTGTGGCCTCCACAGG - Intronic
951798210 3:26566307-26566329 GTCCATCCTCTGCCCTCCTCTGG + Intergenic
953150705 3:40321990-40322012 GCCAGTCCTGTGCCCTTCTGTGG - Intergenic
953257759 3:41306442-41306464 GCCCGGCCAGTGGCCCCATCTGG + Intronic
954325140 3:49859388-49859410 GCCTGGCCTGTGGCGCCCTCTGG + Exonic
954381487 3:50221329-50221351 GCCCTTCCTGGGGCTCCCTCAGG - Intergenic
954405029 3:50340856-50340878 GCCCGCCCTGTGGCCCCGCCCGG - Intronic
954410396 3:50368058-50368080 GCCCGGCCTCTGGGTTCCTCTGG + Intronic
954459275 3:50617257-50617279 GCCCCCTCTGCGGCCTCCTCCGG + Intronic
961450201 3:126999213-126999235 GCCCTTCCTGGGGCCACCTCAGG + Intronic
962245235 3:133785514-133785536 GCCCGGCCAGTGGCCCCGTCCGG + Intronic
962325941 3:134432336-134432358 GCCCTGCTTATGGCCTCCTCAGG + Intergenic
963692343 3:148519822-148519844 GCCAGGCCTGTGTCCTCTTCAGG - Intergenic
967824680 3:193868964-193868986 ACCCTTCCTGTGTCCTCCTCAGG - Intergenic
967979705 3:195058545-195058567 CTCCCTCCTGTGGCCCCCTCTGG + Intergenic
968230917 3:197003869-197003891 GCCCGCCCTGCCGCCTCCCCTGG - Intronic
969290082 4:6233277-6233299 CCCAGGCCTGTGGCCACCTCGGG + Intergenic
969351119 4:6598403-6598425 GCCCCTCCCCTGACCTCCTCAGG - Intronic
969602200 4:8183023-8183045 GCCTCTCCTCTGCCCTCCTCTGG - Intronic
969814992 4:9680223-9680245 GCCAGTCCTGTGCCCTGCACTGG - Intergenic
970520166 4:16875377-16875399 GCAGATCCTGTGGCCTACTCCGG + Intronic
981970790 4:150660369-150660391 GCCCGGCCAGTGGCCCCGTCCGG + Intronic
985751957 5:1685580-1685602 GCCCTTCCTGTGGAATGCTCAGG - Intergenic
988254982 5:28809423-28809445 GCCCGCCCTGAGACCTCCACAGG - Intergenic
991692103 5:69235114-69235136 GCCAGACCTCTGGCCTCCACGGG - Intronic
999633561 5:153596983-153597005 CCCGGTCCCGTGGCCTCCCCAGG + Intronic
1001057054 5:168458366-168458388 GGCCTTCCTCTGGCCTCCTCGGG + Intronic
1002061488 5:176628388-176628410 CCTCATCCTGTGGCCTCATCAGG + Intronic
1006168488 6:32079754-32079776 GCTCTTGCTGTGGCCTCCCCAGG + Intronic
1006420026 6:33927299-33927321 GCCCTTCCTGTCCCCTCCTTCGG + Intergenic
1006797124 6:36738891-36738913 GCCCTCCCTCTGGCCTGCTCAGG + Intergenic
1007364642 6:41382842-41382864 GCCTTCCCTGTGGACTCCTCTGG - Intergenic
1007764736 6:44153896-44153918 GCTTCTCCTGTGGCCTGCTCTGG - Intronic
1015079360 6:129205015-129205037 GCCATTCCTGTGGCTTCTTCAGG + Intronic
1017781736 6:157720746-157720768 GCCCTGCCTGTGGCCTCTTTAGG + Intronic
1019149474 6:169994470-169994492 TGCCGTCCTGTGGCCCCGTCAGG + Intergenic
1019411218 7:907622-907644 GCCCGTCCTTTCTCCTGCTCTGG + Intronic
1024612497 7:51079659-51079681 GCACACCCTGTGGCCACCTCAGG - Intronic
1026878884 7:73895346-73895368 GGCCGTCCCTTGGCCTCCTTGGG + Intergenic
1027221868 7:76219370-76219392 ACCTGTACTGTGGACTCCTCTGG + Intronic
1029381727 7:100219691-100219713 GCCCCTCCCCTGGCCTCCCCAGG + Exonic
1029401894 7:100352141-100352163 GCCCCTCCCCTGGCCTCCCCAGG + Intronic
1029642995 7:101832835-101832857 GGCTGTCCTGTGGCCTGCTCCGG + Intronic
1030066799 7:105665842-105665864 ACCCCTGCTATGGCCTCCTCAGG + Intronic
1032803303 7:135333685-135333707 GCCCATCCTGTGACTTCCTCTGG - Intergenic
1033249655 7:139747710-139747732 AGCCCTCCTGTGGCCTCCACTGG + Intronic
1033411215 7:141119399-141119421 CCCCATCCTGAGGGCTCCTCAGG - Intronic
1034552549 7:151830682-151830704 GCCTGGCCTGAGGCCTCCTGCGG + Intronic
1034691517 7:153017960-153017982 CCCAGTCCTGTCGCCTCCCCTGG - Intergenic
1034974345 7:155439193-155439215 GCCTGTCCTGTGGCCACAGCTGG - Intergenic
1035024815 7:155818586-155818608 CCCCTTCCTGTGGCATCCACTGG + Intergenic
1035206753 7:157298610-157298632 GCCTGTTCTGTGGGCGCCTCTGG - Intergenic
1035455819 7:159007926-159007948 GCAGGTCCCGTGGCCTCCTGGGG + Intergenic
1036789683 8:11709337-11709359 GCCCGCCCTCGGGCCTCCGCAGG + Intronic
1037684937 8:21130666-21130688 GCCCTTCCTGTTGGCACCTCTGG + Intergenic
1037829045 8:22177427-22177449 GGCCGTCCTGGGGACTGCTCAGG + Intronic
1039595508 8:38787298-38787320 GCCCGTCCTGTGGCCTCCTCAGG - Exonic
1040567928 8:48583062-48583084 GCCCTTCCTGGGACCCCCTCAGG + Intergenic
1040994383 8:53387351-53387373 GCCCTACCTCAGGCCTCCTCAGG - Intergenic
1041881161 8:62751157-62751179 ACCCTTCCTGTGCCATCCTCAGG + Intronic
1041903575 8:63008180-63008202 GCCCCTCCTGTGGCCTGCATGGG + Intergenic
1047388531 8:124431893-124431915 GCCCGGCCAGTCGCCTCGTCTGG - Intergenic
1047694794 8:127392844-127392866 GCTCATCCTGTGCCCTCCCCTGG - Intergenic
1049179785 8:141216275-141216297 GCCCGCTCAGTGGCCTTCTCTGG + Intronic
1049453203 8:142673722-142673744 GCCGGTCCTGTGGCCCCACCTGG - Intronic
1049846226 8:144803150-144803172 GGGCTTCCTGCGGCCTCCTCTGG + Intronic
1050165761 9:2763213-2763235 ACCAGTCCTGTGGCCCCCACAGG - Intronic
1053161177 9:35814560-35814582 GCCAGTGCTCTGCCCTCCTCAGG - Intronic
1053279155 9:36806128-36806150 CCCGGCCCTGTGGCCTCCTGTGG - Intergenic
1053692480 9:40593245-40593267 GCCCTGCCTTTGGCCTGCTCTGG + Intergenic
1054272337 9:63044288-63044310 GCCCTGCCTTTGGCCTGCTCTGG - Intergenic
1054303722 9:63394163-63394185 GCCCTGCCTTTGGCCTGCTCTGG + Intergenic
1054402500 9:64720673-64720695 GCCCTGCCTTTGGCCTGCTCTGG + Intergenic
1054436110 9:65205004-65205026 GCCCTGCCTTTGGCCTGCTCTGG + Intergenic
1054494282 9:65816683-65816705 GCCCTGCCTTTGGCCTGCTCTGG - Intergenic
1056826550 9:89880010-89880032 GCCACTTCTGTGGCCTGCTCAGG - Intergenic
1057298386 9:93862312-93862334 GTCCTTCCTGTAGCGTCCTCTGG + Intergenic
1057801947 9:98196149-98196171 GCCTGGCCTGTGGCCTCCTGGGG - Intergenic
1058659609 9:107256926-107256948 GCCCGGCCAGTGGCCCCGTCCGG - Intergenic
1060027163 9:120183064-120183086 GCCCATACTGTGAGCTCCTCTGG + Intergenic
1060831954 9:126722714-126722736 GCCCGGCCTGTGCCCTACTCTGG - Intergenic
1060926934 9:127461628-127461650 GCCTGCCCAGTGGACTCCTCAGG - Intronic
1061015916 9:127980760-127980782 GTCCGGCCTCGGGCCTCCTCAGG + Intergenic
1062021405 9:134321089-134321111 GGCTGTCCTGAGGCCTCCTCGGG + Intronic
1062069365 9:134547272-134547294 GCCCGTCCTGTGGACGGCTCTGG + Intergenic
1062394562 9:136347607-136347629 GTCCGTCCCGCCGCCTCCTCAGG + Intronic
1062623921 9:137434546-137434568 GCCCCTCCTGAGGCCCCATCAGG + Exonic
1203463985 Un_GL000220v1:68456-68478 GCCCGGCCAGCCGCCTCCTCCGG - Intergenic
1190480353 X:50870792-50870814 CCCCATCCTGTGGCCAGCTCAGG + Intergenic
1191933871 X:66405072-66405094 GCCTGTCCTGGGGTCTCATCTGG - Intergenic
1192380884 X:70614591-70614613 GCTAGTCCTGTGTCCTCTTCAGG - Intronic
1200285916 X:154822199-154822221 GCCTGTCATGTGGCCTGCTGTGG - Intergenic