ID: 1039596692 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:38796897-38796919 |
| Sequence | TCTCACATAGTCTTTGTAGT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1039596691_1039596692 | -1 | Left | 1039596691 | 8:38796875-38796897 | CCAAAACTGAAAACAACGAACAT | 0: 1 1: 1 2: 13 3: 166 4: 905 |
||
| Right | 1039596692 | 8:38796897-38796919 | TCTCACATAGTCTTTGTAGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1039596692 | Original CRISPR | TCTCACATAGTCTTTGTAGT TGG | Intronic | ||
| No off target data available for this crispr | |||||