ID: 1039596692

View in Genome Browser
Species Human (GRCh38)
Location 8:38796897-38796919
Sequence TCTCACATAGTCTTTGTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039596691_1039596692 -1 Left 1039596691 8:38796875-38796897 CCAAAACTGAAAACAACGAACAT 0: 1
1: 1
2: 13
3: 166
4: 905
Right 1039596692 8:38796897-38796919 TCTCACATAGTCTTTGTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039596692 Original CRISPR TCTCACATAGTCTTTGTAGT TGG Intronic
No off target data available for this crispr