ID: 1039598623

View in Genome Browser
Species Human (GRCh38)
Location 8:38813904-38813926
Sequence GTTTCATAGAAATTAAGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039598617_1039598623 22 Left 1039598617 8:38813859-38813881 CCACTCACACTAGCTCAAATATG 0: 1
1: 0
2: 0
3: 15
4: 145
Right 1039598623 8:38813904-38813926 GTTTCATAGAAATTAAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039598623 Original CRISPR GTTTCATAGAAATTAAGCTG GGG Intronic
No off target data available for this crispr