ID: 1039599822

View in Genome Browser
Species Human (GRCh38)
Location 8:38826595-38826617
Sequence TCATTTGGATAGTTTCTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039599820_1039599822 -8 Left 1039599820 8:38826580-38826602 CCATGCAGATGTTTTTCATTTGG 0: 1
1: 0
2: 3
3: 49
4: 393
Right 1039599822 8:38826595-38826617 TCATTTGGATAGTTTCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039599822 Original CRISPR TCATTTGGATAGTTTCTTGA TGG Intronic
No off target data available for this crispr