ID: 1039601968

View in Genome Browser
Species Human (GRCh38)
Location 8:38846867-38846889
Sequence TAAGTGAGTCACTGCTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039601968_1039601972 0 Left 1039601968 8:38846867-38846889 CCTCCTCAGCAGTGACTCACTTA 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1039601972 8:38846890-38846912 ATGACAGATCTGGGTGAAAGAGG 0: 1
1: 0
2: 1
3: 11
4: 204
1039601968_1039601973 6 Left 1039601968 8:38846867-38846889 CCTCCTCAGCAGTGACTCACTTA 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1039601973 8:38846896-38846918 GATCTGGGTGAAAGAGGCCTTGG 0: 1
1: 0
2: 0
3: 21
4: 253
1039601968_1039601971 -9 Left 1039601968 8:38846867-38846889 CCTCCTCAGCAGTGACTCACTTA 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1039601971 8:38846881-38846903 ACTCACTTAATGACAGATCTGGG 0: 1
1: 0
2: 1
3: 12
4: 178
1039601968_1039601970 -10 Left 1039601968 8:38846867-38846889 CCTCCTCAGCAGTGACTCACTTA 0: 1
1: 0
2: 1
3: 6
4: 132
Right 1039601970 8:38846880-38846902 GACTCACTTAATGACAGATCTGG 0: 1
1: 0
2: 2
3: 11
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039601968 Original CRISPR TAAGTGAGTCACTGCTGAGG AGG (reversed) Intronic
900599282 1:3496220-3496242 GCAGTGAGTCACTGCAGAGCAGG - Intronic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
910012791 1:82486229-82486251 AAAGAGAGACCCTGCTGAGGGGG - Intergenic
913527491 1:119708083-119708105 TGTGTCAGGCACTGCTGAGGGGG - Intronic
914385461 1:147165400-147165422 TCAGTGATTCTCAGCTGAGGAGG - Intronic
915035988 1:152925584-152925606 CAGGTGAGGCACTGCTGTGGAGG + Intergenic
921999234 1:221457816-221457838 TATGTAAGTTGCTGCTGAGGAGG + Intergenic
922311212 1:224392850-224392872 TAAGTGATTCTCTGTGGAGGAGG - Intronic
923046661 1:230360999-230361021 TAAGTGACTCACAGCTGGGGAGG + Intronic
1063265988 10:4451443-4451465 TATGTGATTCATTGGTGAGGAGG + Intergenic
1063543167 10:6955025-6955047 TCAGTGCCACACTGCTGAGGAGG - Intergenic
1065344494 10:24735896-24735918 TAGGTGAGTGACAGATGAGGTGG - Intergenic
1067684421 10:48458133-48458155 TATGGGGGTCACTGCTGAGATGG + Intronic
1069330505 10:67286575-67286597 TAAGTAAGTAATTGCAGAGGGGG - Intronic
1076283837 10:129274561-129274583 TAAGTGCGACACTGGAGAGGTGG - Intergenic
1076371143 10:129954788-129954810 CAAATGAGACACTGCTGATGGGG + Intronic
1077769650 11:5201891-5201913 TAAGTTATTCAATGCTGAGAAGG - Intergenic
1079470185 11:20770595-20770617 TTCCAGAGTCACTGCTGAGGAGG - Intronic
1080223991 11:29939363-29939385 TAAGTGAGTCAGTGGTTAGGGGG - Intergenic
1080318919 11:30983672-30983694 GAACTTAGTCACTGCTGAGGTGG - Intronic
1082015005 11:47478853-47478875 TAAGTGTTTCACTGCTGCAGAGG - Intronic
1083455352 11:62775115-62775137 TAACTGACTCAATGCTGGGGAGG + Intronic
1083823585 11:65186048-65186070 CAAGTGAGTAGCGGCTGAGGGGG + Exonic
1085125876 11:74002072-74002094 TTGGTGAGCCACAGCTGAGGTGG - Intronic
1090334289 11:125952174-125952196 AAAGTGAGTCAGTGCGGACGGGG + Intergenic
1090402230 11:126456327-126456349 GGTGAGAGTCACTGCTGAGGGGG - Exonic
1094033475 12:26040667-26040689 TAAGTAAGTTACCACTGAGGAGG - Intronic
1095951987 12:47786561-47786583 TAAGGGAGCCTCAGCTGAGGGGG - Intronic
1096195865 12:49648438-49648460 TGAGTGAGCCCATGCTGAGGGGG - Intronic
1096765445 12:53884972-53884994 AAATTGAGTTACTGCAGAGGAGG + Intergenic
1096766087 12:53890987-53891009 TAGGTCAGTCACTTCTGAGATGG - Intergenic
1098279757 12:68850466-68850488 TAAATGAGACATTGCTGAGTAGG - Exonic
1099837658 12:87927806-87927828 CAGTTAAGTCACTGCTGAGGTGG + Intergenic
1100437246 12:94582929-94582951 TAAGTGAGTGAGTTCTGAGTTGG - Intronic
1105464624 13:20626704-20626726 TAATTGAGAGACTGCTGAAGGGG - Intronic
1105580542 13:21691729-21691751 CAAGTCAGTCCCTGGTGAGGGGG - Intronic
1107735795 13:43397377-43397399 AGAGTGAATCACTGCTGATGAGG - Intronic
1107823377 13:44306164-44306186 TAAATGAGGAACTGGTGAGGAGG + Intergenic
1109767687 13:66926665-66926687 TATGTGAGTGACTGCTTTGGTGG - Intronic
1112006108 13:95255168-95255190 TAAGTGACTGAGTGCTGGGGAGG + Intronic
1112659587 13:101492329-101492351 TAAATGAATAACTGCTGAGCAGG - Intronic
1116067592 14:40003841-40003863 TAAGTGAGTTAGTGGGGAGGAGG + Intergenic
1117675233 14:58148967-58148989 TTAGTGATTCTCTGATGAGGGGG + Intronic
1121751558 14:96362554-96362576 TAATTGAGTCAGTGCTTCGGGGG - Intronic
1122430171 14:101635296-101635318 TTAGTGAGTACCTGCAGAGGGGG - Intergenic
1128370772 15:67037395-67037417 TAAGTGAATCCTTGCTGAAGAGG - Intergenic
1135265541 16:21022481-21022503 TATGTTAGACACTGGTGAGGTGG + Intronic
1138876353 16:60955536-60955558 TAATTGACTCACAGCTAAGGAGG + Intergenic
1146270034 17:31478837-31478859 TGACTGAGACACTGCTGAGCTGG + Intronic
1147120215 17:38331193-38331215 TTCTTGACTCACTGCTGAGGAGG - Exonic
1148149585 17:45388741-45388763 TCAGTGAGTCACTGATGCTGTGG + Intergenic
1156854982 18:41771203-41771225 TAAGTGAGAGACTGATTAGGAGG + Intergenic
1157149142 18:45197569-45197591 TTGCTGAGTCACTGCTGAGAAGG - Intergenic
1157684459 18:49631218-49631240 TAGGTGAGTCAGGGGTGAGGTGG - Intergenic
1161061880 19:2219376-2219398 CTAGGGAGTGACTGCTGAGGCGG - Intronic
1165657096 19:37543559-37543581 TAAGTGTTTCGCTGATGAGGTGG - Intronic
925839566 2:7978878-7978900 TATGTGAGTCACTTCTGAGAAGG + Intergenic
926359688 2:12074536-12074558 CCAGTCAGTCACTGCTTAGGAGG + Intergenic
927522189 2:23705829-23705851 TAAGGGAGTCAGTGCAGAGAGGG + Intronic
930112395 2:47689685-47689707 TAAATGACTCACTTCTGATGAGG - Intergenic
931909767 2:66886117-66886139 TAAATGAGTTACTGCAGATGGGG + Intergenic
937062502 2:118990990-118991012 CAAGTGGGCCACAGCTGAGGTGG - Intronic
937277246 2:120692860-120692882 TAAGTGATTAACTTCTGAGCAGG - Intergenic
937383474 2:121403761-121403783 TGAGAGAGTCCCAGCTGAGGGGG - Intronic
942878167 2:180827512-180827534 GAAGTGAGACAATGGTGAGGTGG + Intergenic
945454794 2:210037632-210037654 TAAGTTGTTCACTGCTGAGACGG - Intronic
946436511 2:219659878-219659900 TAAGTGTGGCACAGCGGAGGGGG - Intergenic
946459592 2:219857130-219857152 GTAGTGAGGCGCTGCTGAGGAGG - Intergenic
947361606 2:229350848-229350870 TGAATCAATCACTGCTGAGGGGG - Intergenic
947724199 2:232387381-232387403 TATGTGAGTCACTGCGGCGCGGG - Intergenic
948342417 2:237265063-237265085 TCTGTGAGTCAGTGCTGTGGCGG - Intergenic
948422180 2:237866479-237866501 AGAGTGACTCACTGCTGAGTAGG + Intronic
1179300035 21:40099921-40099943 TAAGTGAGCCACACCTGAGAAGG + Intronic
1179851578 21:44141152-44141174 TAAGTGAGTGACTGTGGATGGGG - Intronic
1181648858 22:24247939-24247961 TAAATGAGGCACTGGAGAGGCGG - Intergenic
1182932176 22:34184985-34185007 TAAGTGAGTGTGTGTTGAGGGGG + Intergenic
949568135 3:5264458-5264480 TAAGTGACTTACTGCTGTGCTGG - Intergenic
952204993 3:31172398-31172420 TAAGTGAGACCCCTCTGAGGAGG + Intergenic
953469406 3:43154337-43154359 AAAGTGCTCCACTGCTGAGGGGG - Intergenic
965735383 3:171814088-171814110 TCAGTGAGTCACTGTTATGGTGG - Intergenic
967532937 3:190569974-190569996 GTAGTGAGTCACTGCTAAGGTGG - Intronic
973195729 4:47437928-47437950 TCACTGATTCACTGCTTAGGAGG - Intergenic
973872579 4:55181134-55181156 TCTGTGAGTCACAGCAGAGGGGG + Intergenic
977291430 4:95169154-95169176 CAGGTGAATCACAGCTGAGGAGG - Exonic
979963734 4:127052096-127052118 TACGTGAGTAACAGTTGAGGTGG + Intergenic
981204126 4:142018629-142018651 TAAGTGAATCACGGGGGAGGGGG - Intergenic
982987637 4:162231432-162231454 TAATTGATGCACTGCTGGGGAGG + Intergenic
985331360 4:188840014-188840036 AATGTGAGTCACTGGTGAAGTGG - Intergenic
986611705 5:9574756-9574778 TATGTGTGTCACTTCTGAGCTGG - Intergenic
988484752 5:31659371-31659393 TGTGTGAGTCAGTGCTCAGGAGG - Intronic
989149454 5:38284090-38284112 AAAGTGAGGCACTACTGAAGGGG + Intronic
990159394 5:52920843-52920865 TAAGTGATTAACTGCTCTGGGGG + Intronic
990634368 5:57708465-57708487 AAAGGGAGTCTCTGCTGAGCAGG + Intergenic
993871743 5:93261773-93261795 TCAGTGTGCCCCTGCTGAGGGGG - Intergenic
994255009 5:97582272-97582294 TAAGTGAGTCTCTACTCTGGGGG + Intergenic
994342139 5:98642817-98642839 TAAATGAGTCACTGATTGGGGGG + Intergenic
996092079 5:119361336-119361358 TGAGTGACTAACTGCTGAGTTGG + Intronic
996139975 5:119895100-119895122 GAAGTCCATCACTGCTGAGGTGG + Intergenic
999422680 5:151458481-151458503 GAAGTGAGGCACTGCTTGGGAGG - Intronic
999620446 5:153467401-153467423 TAAATAAGTCACTGATGATGGGG - Intergenic
1000184241 5:158843535-158843557 CAAGTGATCCACTGTTGAGGGGG - Intronic
1000496474 5:161990690-161990712 GAAGTGAGTCACAGCTTATGTGG + Intergenic
1001654893 5:173341811-173341833 AAAGTAAGTCACTGCAGGGGTGG - Intergenic
1004333645 6:14744138-14744160 CAAGTGAGTCACTGGTGAGGCGG - Intergenic
1006678625 6:35781164-35781186 AAAGTGAGCCCCTGGTGAGGAGG - Exonic
1011344317 6:86352401-86352423 CAACTGAGTCAGTCCTGAGGAGG + Intergenic
1012111032 6:95234036-95234058 TATGTGAGCCAGTGCTGAGATGG + Intergenic
1012265729 6:97139732-97139754 TGAGTGAGTCTCTACTGAGCAGG - Exonic
1014083852 6:117318721-117318743 TAAGAGAAAAACTGCTGAGGCGG + Intronic
1016400398 6:143673806-143673828 TGCGTGAGTCTCTGCAGAGGCGG - Intronic
1016986989 6:149903024-149903046 TAAGGGAATTACTGCTAAGGTGG + Intergenic
1017115852 6:150975807-150975829 TAAATGAGGTACTGCTCAGGGGG - Intronic
1021624924 7:22583663-22583685 TAAGTCACTCACTGTTGGGGTGG + Intronic
1022318462 7:29265741-29265763 TTGGTGAGTGACAGCTGAGGAGG + Intronic
1022371307 7:29774094-29774116 TAAGTGAGCCATGGTTGAGGAGG + Intergenic
1022627898 7:32056984-32057006 TAAGTGGGACATTGCTGGGGTGG - Intronic
1023794490 7:43780526-43780548 TAAGTGAGGAAGTGATGAGGAGG - Intronic
1031599503 7:123688897-123688919 TAATTGAGTAACTACTGATGTGG - Intronic
1034776975 7:153836936-153836958 TAAGAGAGTGGCTGCTGCGGAGG + Intergenic
1036685026 8:10903915-10903937 CAAGTGAGCCACTGCAGAGAAGG - Intronic
1036885782 8:12551937-12551959 TGAGCCAGTCACTGGTGAGGGGG - Intergenic
1037089127 8:14891392-14891414 GGAGAGAGTCACTGCAGAGGAGG + Intronic
1038450780 8:27637581-27637603 GAAGTGACTCAGTGGTGAGGTGG + Intronic
1039601968 8:38846867-38846889 TAAGTGAGTCACTGCTGAGGAGG - Intronic
1044431367 8:92111598-92111620 TAACTGAGTCACTGCTATTGTGG - Intergenic
1046182240 8:110666159-110666181 GAAGTGGGTCATTGCTGAAGGGG - Intergenic
1047885799 8:129248963-129248985 TAAGTGACTCAGTGGAGAGGTGG - Intergenic
1049587748 8:143439928-143439950 TACCTGAGTCCTTGCTGAGGGGG + Intronic
1051725401 9:20083741-20083763 TAAATGAATAATTGCTGAGGGGG - Intergenic
1056557272 9:87700076-87700098 ACATTGACTCACTGCTGAGGAGG + Intronic
1059426931 9:114227097-114227119 TAAGTATGTCACAGCTAAGGAGG + Intronic
1059633516 9:116150721-116150743 TAAGGGAGTCCCTGGGGAGGAGG + Intergenic
1061822007 9:133234186-133234208 CGAGTGAGTCACTGGGGAGGTGG - Intergenic
1062237287 9:135516327-135516349 CGAGTGAGTCACTGCGGAGGTGG + Intergenic
1203776849 EBV:78045-78067 TGGGGTAGTCACTGCTGAGGTGG + Intergenic
1203776867 EBV:78108-78130 TGGGGTAGTCACTGCTGAGGTGG + Intergenic
1190328100 X:49218967-49218989 CCACTGAGTCACGGCTGAGGGGG + Intronic
1194054861 X:89119051-89119073 TAACTAAGTCAGTGCTGAGAGGG - Intergenic
1197964901 X:132049753-132049775 TCAGTGACTCATTGATGAGGAGG - Intergenic
1199924256 X:152446021-152446043 TAAGTAAGTCACTGCTCCTGTGG + Intronic