ID: 1039609099

View in Genome Browser
Species Human (GRCh38)
Location 8:38904806-38904828
Sequence AAAGTTGCTTAACACTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039609099_1039609102 12 Left 1039609099 8:38904806-38904828 CCTGCCCAGTGTTAAGCAACTTT 0: 1
1: 0
2: 0
3: 5
4: 156
Right 1039609102 8:38904841-38904863 ATGACCATGTACTCCTTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039609099 Original CRISPR AAAGTTGCTTAACACTGGGC AGG (reversed) Intronic
906531881 1:46528417-46528439 CAAGATGCCTAACTCTGGGCAGG - Intergenic
907148238 1:52256463-52256485 AAAATTGCTTAAACCTGGGAAGG - Intronic
907296655 1:53460007-53460029 AAAGTCGGTGAACAGTGGGCCGG - Exonic
908484594 1:64578024-64578046 AAAGGTCCTCAACTCTGGGCTGG - Intronic
909870914 1:80737296-80737318 CAAGATGCTTAAAACTGGCCAGG - Intergenic
910758098 1:90712156-90712178 GAAGATGCTTACCAGTGGGCAGG - Exonic
912109853 1:106328257-106328279 AAAATTGCTGAACACAGGGAAGG + Intergenic
917710122 1:177676387-177676409 CAAGTTGGTAAACACTGTGCAGG - Intergenic
918633709 1:186749656-186749678 AAAGGTGCTTAACACTTGAGGGG - Intergenic
923158269 1:231297023-231297045 AAAGGTGTCTAAGACTGGGCAGG - Intergenic
1065698746 10:28404284-28404306 AAAGTTGCTTAGGGCCGGGCAGG + Intergenic
1066165942 10:32788481-32788503 AAAATTACCTGACACTGGGCAGG - Intronic
1067959382 10:50831176-50831198 AAAGTTTCTTGACATTGGTCTGG + Intronic
1070187823 10:74083413-74083435 AAAGTTGGTGAACTCTGTGCAGG + Exonic
1070418341 10:76210930-76210952 AAAGTTGCTTAAAAATGGTTTGG + Intronic
1073467632 10:103703471-103703493 AAAGTTGTGAAACACTAGGCAGG - Intronic
1075374512 10:121967492-121967514 AAAGTTCATAAACACTAGGCCGG - Intronic
1078215154 11:9305714-9305736 AAAGTAAGTTAAAACTGGGCTGG - Intronic
1080795909 11:35563342-35563364 AAAGTTTCTAAACACAGGACAGG - Intergenic
1092004288 12:5055936-5055958 AAAGTTGCAGAACAGTGGCCGGG - Intergenic
1093694638 12:22146015-22146037 AGAGTTGCTTTAAACTGGGTAGG + Intronic
1094318236 12:29155494-29155516 AAAGCTGCTGACCCCTGGGCTGG - Intronic
1095390861 12:41704955-41704977 AAAATTGCTTAAACCTGGGGGGG - Intergenic
1096966880 12:55635558-55635580 AAAGTTACTTAACACTGTCTGGG + Intergenic
1098279561 12:68849005-68849027 AAAAATGCTTAACTTTGGGCTGG - Exonic
1098600140 12:72321426-72321448 AAAGTGGGTTAACACTGTTCAGG + Intronic
1099503487 12:83445043-83445065 AAAGTTGCTGAACAATAAGCAGG - Intergenic
1102386520 12:112514940-112514962 AAAATTGCTTAAACCTGGGGGGG - Intergenic
1104583416 12:130028160-130028182 AAAATTGCTGAACACAGAGCTGG - Intergenic
1105695494 13:22884239-22884261 ACAGTGGCTGAACACTGGGAAGG + Intergenic
1106633855 13:31506346-31506368 AAATTTGCTGATAACTGGGCAGG - Intergenic
1108573336 13:51770915-51770937 AAGGTTGCTTATCACAGTGCTGG - Intronic
1108628087 13:52252191-52252213 AAAGTTTCTTGACACTGGTCTGG + Intergenic
1108657972 13:52554258-52554280 AAAGCTTCTTGACACTGGTCTGG - Intergenic
1109442390 13:62392971-62392993 AAATTTGATAAAAACTGGGCTGG - Intergenic
1110653970 13:77975381-77975403 ACAGTGGCTGAACACTGGGAAGG - Intergenic
1112628478 13:101134366-101134388 AAAGATGTTTCACACAGGGCAGG - Intronic
1114408632 14:22479660-22479682 AAAGATGCTAATAACTGGGCAGG - Intergenic
1117589632 14:57254137-57254159 AAAGATGCCTAACACTGGCTGGG + Intronic
1118044817 14:61956375-61956397 AAAGCTGCTAAACACTGAACTGG - Intergenic
1118874781 14:69774443-69774465 AAAGTAGCTTAATTCTTGGCTGG - Intergenic
1125168262 15:36736869-36736891 AAAAATGCTTCACACTGGCCGGG + Intronic
1128528716 15:68430292-68430314 AAAGGCCCTTAACACAGGGCTGG - Intronic
1135288955 16:21218141-21218163 AAAGTTGCTTATCTGTGTGCAGG - Intergenic
1135774839 16:25248166-25248188 AAAGCTCCTTGACACTGGTCTGG + Intronic
1136297538 16:29312237-29312259 AAAGGTGCTCCACACAGGGCTGG - Intergenic
1137041864 16:35620669-35620691 ACAGTGGCTGAACACTGGGAAGG - Intergenic
1139629894 16:68223949-68223971 AAAATTGCTTATCACTGGCCAGG + Intronic
1139830142 16:69790869-69790891 TAAGATGCTAAACACTGGCCGGG - Intronic
1144783818 17:17821020-17821042 AAAGTTGCTTAGTTCTAGGCAGG - Intronic
1146659495 17:34654939-34654961 AAAGTTTGTTAACTCCGGGCAGG - Intergenic
1146810537 17:35899589-35899611 AAAGCTGCCTAACATTGAGCTGG + Intergenic
1147634974 17:41958362-41958384 AAAGTTAATTAAAACTAGGCTGG + Intronic
1151146883 17:72049441-72049463 AAAGTTACTCCACTCTGGGCTGG + Intergenic
1151464683 17:74276899-74276921 ACAGTTGCTTCACACTGTGTTGG + Intronic
1151606451 17:75140210-75140232 AAAGTTTCTAAACATTTGGCTGG - Intronic
1152994021 18:389573-389595 AAAATTGCTGCACAGTGGGCTGG - Intronic
1158009989 18:52717490-52717512 ATTGTGGCTGAACACTGGGCTGG - Intronic
1160408184 18:78657144-78657166 AAACTTCATTAACACTGGGTAGG - Intergenic
1161235237 19:3194435-3194457 AGAGTTGGCTAACACTGGCCAGG + Intronic
1163923178 19:20312809-20312831 AAAGGTGCTTAACACGGCCCAGG + Intergenic
1165125272 19:33591174-33591196 AAGGTTGCTGAAGACTGGGGTGG - Intergenic
1165213136 19:34251368-34251390 AGAATTGCTTAAAACTGGGAGGG + Intergenic
1167342460 19:48923786-48923808 AAAGTTGCTTAATCCCGGCCAGG - Intergenic
1167692814 19:50997345-50997367 AAAGTGGCTGACCACCGGGCCGG + Intronic
928741515 2:34359309-34359331 AATGTTGATTAGCACTGGCCGGG + Intergenic
929214330 2:39394867-39394889 AAAGTTTCTTGAGACTGGCCTGG + Intronic
931686938 2:64802030-64802052 CCAGCTGCTTATCACTGGGCAGG - Intergenic
933124280 2:78585001-78585023 ACATTTGCTGAACACTGGCCTGG - Intergenic
934495650 2:94795080-94795102 AAAGTTTCTTTGCACTGGCCAGG - Intergenic
934776702 2:96943300-96943322 AAAGTTGATTAACAGTTGCCAGG - Intronic
935023321 2:99252748-99252770 AAAAATGCTTATCACTGGGCCGG + Intronic
935655127 2:105415580-105415602 AAGGTGGCTTCACAATGGGCAGG + Intronic
937088854 2:119191554-119191576 ACAGTAGCTTAACACATGGCTGG + Intergenic
937673954 2:124568724-124568746 AAAGATGCTTAACATAGTGCTGG - Intronic
938167358 2:129042727-129042749 CAAGTTGCAAAACACTGTGCAGG - Intergenic
943326510 2:186504994-186505016 AAATTTGCTGAACACTTGCCAGG - Intronic
943691734 2:190876316-190876338 AGACTTTCTTAACTCTGGGCTGG + Intergenic
945330518 2:208534804-208534826 ATAGTTGCTAAAGACTGGGGAGG - Intronic
946935260 2:224713565-224713587 CTAGTTGTTCAACACTGGGCAGG - Intergenic
1169282981 20:4282896-4282918 ACAGTTGCTTGACACAGGTCTGG - Intergenic
1170401198 20:15985537-15985559 ACAGTGGCTGAACACTGGGAAGG - Intronic
1170754319 20:19185611-19185633 AAAGTTGCTAAAAAATGTGCAGG + Intergenic
1171094662 20:22320087-22320109 AAATATACTTAACACTGGGCAGG + Intergenic
1176003366 20:62845018-62845040 AAAGTTGCTTAAAAGTGGATGGG - Intronic
1176964146 21:15193068-15193090 AAAATTGCTTTACATTGGCCGGG - Intergenic
1177641464 21:23849009-23849031 AAAGTTGTTTAACACTGTCCAGG - Intergenic
1180016050 21:45084848-45084870 TAAGTGACTTAACACTGGGTGGG - Intronic
1180619062 22:17147972-17147994 ACAGTTGCTTAAAACGGGCCAGG + Intronic
1182379433 22:29874504-29874526 AAAGCTTCATAACACTGGTCTGG - Intergenic
1183068325 22:35379126-35379148 AAAAGGGCTTAACACTGGCCGGG - Intergenic
949699697 3:6742398-6742420 AAAGCAGCTAAACACTTGGCTGG - Intergenic
950286237 3:11747355-11747377 AAAGTTCCATCACACTGGCCGGG - Intergenic
952286217 3:31972090-31972112 AAAGTTTCCCAACTCTGGGCCGG + Intronic
956995898 3:74825711-74825733 ACAGTGGCTGAACACTGGGAAGG + Intergenic
959410628 3:106016724-106016746 ATGGTTGTTTAACACTAGGCAGG - Intergenic
964501443 3:157352806-157352828 AAACTTGAAAAACACTGGGCTGG - Intronic
964936398 3:162094263-162094285 AAAAATGATTAAAACTGGGCAGG - Intergenic
965171588 3:165271647-165271669 AAAGATGCTTATTTCTGGGCCGG - Intergenic
965398772 3:168193397-168193419 AAAGGTACTTAACTCTGGGAAGG + Intergenic
967653777 3:192020311-192020333 AAAGTTTCTTGACATTGGGTTGG + Intergenic
968330327 3:197863586-197863608 AAAGCTGCTGAAGACTTGGCAGG - Intronic
968664155 4:1811526-1811548 AAAGGTGCTTAACACGGCCCAGG + Exonic
971481957 4:27122989-27123011 AATGGCGTTTAACACTGGGCAGG - Intergenic
973370408 4:49242006-49242028 AAAGTTTCTTTGCACTGGCCAGG - Intergenic
973390615 4:49553412-49553434 AAAGTTTCTTTGCACTGGCCAGG + Intergenic
974528665 4:63079246-63079268 ACAGTTGCTTGCCACTAGGCTGG - Intergenic
977120365 4:93092207-93092229 AAAGATGCTCAACAATGGCCTGG - Intronic
977250233 4:94681274-94681296 GAAGTTGCTTCAGACTGAGCTGG + Intergenic
977972080 4:103224297-103224319 ACAGTGGCTGAACACTGGGAAGG + Intergenic
981256698 4:142669726-142669748 AAAGTTCCATAACATTGGTCTGG + Intronic
981582954 4:146268976-146268998 AAAGGTGCTTATTACTTGGCAGG + Intronic
984295981 4:177855042-177855064 AAAGTTGTATAAGACTGGGGTGG - Intronic
987879331 5:23721448-23721470 GTGATTGCTTAACACTGGGCAGG + Intergenic
989307750 5:39977257-39977279 AATTTTTCTTAACTCTGGGCTGG - Intergenic
990375930 5:55171015-55171037 AAAGTTACTTAACTGTAGGCTGG + Intronic
992938613 5:81738867-81738889 AAAATTGCTTATCTCAGGGCGGG + Intronic
998229030 5:140347514-140347536 AGAGTTGTTTGACACAGGGCTGG + Intergenic
998594295 5:143512205-143512227 AAAGATGATTATGACTGGGCAGG + Intergenic
1000974824 5:167753230-167753252 AAAGTTGCTAAAAACTTGGAAGG + Intronic
1002412423 5:179092955-179092977 AGAGTTGCTTAAACCTGGGAGGG - Intergenic
1003889446 6:10551000-10551022 GAAATTGTTTAACACTGGGAGGG - Intronic
1005853407 6:29840343-29840365 AAAGTGGCTGAACACTGTGGTGG + Intergenic
1008225095 6:48905220-48905242 AAAGCTTCTTGACACTGGTCTGG + Intergenic
1008599838 6:53081567-53081589 AAAGCAGCTTACTACTGGGCTGG - Intronic
1009753424 6:67902300-67902322 AAAATTGCTCAAAACTGGCCAGG - Intergenic
1011011434 6:82707979-82708001 AAAGTTTCTTGATACTGGTCTGG - Intergenic
1012370252 6:98496499-98496521 GAAGTAGCTTAAGAGTGGGCTGG + Intergenic
1012402261 6:98851260-98851282 AAAGTTCCTTGACATTGGTCTGG + Intergenic
1015102125 6:129493654-129493676 AAAATTGTTTAGCCCTGGGCTGG - Intronic
1015761348 6:136664658-136664680 AGAGTTGCTGTACACTCGGCCGG + Intronic
1017287465 6:152692593-152692615 AAAGCTTCTTGACACTGGTCTGG - Intergenic
1017585667 6:155919737-155919759 AAAATTGCTTAATTCTGGCCAGG - Intergenic
1018492974 6:164315721-164315743 GAATCTGCTTCACACTGGGCAGG - Intergenic
1021249399 7:18305692-18305714 AAAGTTTCTGATCTCTGGGCAGG + Intronic
1026580398 7:71611351-71611373 AAAGTCAGCTAACACTGGGCTGG - Intronic
1026605841 7:71815127-71815149 AAAGTTGATTAACTCAAGGCTGG - Intronic
1028587113 7:92463353-92463375 AAAAATGGTTAATACTGGGCTGG + Intergenic
1032899446 7:136290369-136290391 TATGTTCCCTAACACTGGGCTGG - Intergenic
1034478875 7:151304479-151304501 AAAGGTGCTTAACACAGCCCCGG - Intergenic
1036118567 8:5988472-5988494 AAAGTTGCTCAACACAGGATGGG - Intergenic
1036791057 8:11720392-11720414 AGAGTTGCTTAAAACAAGGCAGG - Intronic
1039609099 8:38904806-38904828 AAAGTTGCTTAACACTGGGCAGG - Intronic
1039629044 8:39088550-39088572 AAAGTTGTATAAAACTGGCCGGG - Intronic
1041009207 8:53524979-53525001 ACAGTGGCTGAACACTGGGAAGG - Intergenic
1043482856 8:80670391-80670413 AAAGGTTCTGGACACTGGGCTGG - Intronic
1045218146 8:100169384-100169406 ATAGCTGCTTAACTCTAGGCTGG + Intronic
1048455698 8:134576386-134576408 TCTGTTGCTTATCACTGGGCTGG - Intronic
1048462955 8:134638025-134638047 AATGGTGCTTAACAAGGGGCAGG - Intronic
1050829301 9:9990633-9990655 AAAGTAGTTTAGCCCTGGGCTGG + Intronic
1051703429 9:19850626-19850648 ATAGTTGCTTAAGGCTGGGATGG - Intergenic
1052083453 9:24235315-24235337 TATGTTGCTAAACACTGGACTGG + Intergenic
1055089386 9:72347381-72347403 AAAATTGTGTAACACTGGCCAGG + Intergenic
1057603828 9:96483749-96483771 AAACTTTCTTAACCCTGGACTGG - Intronic
1059376459 9:113885519-113885541 AAACTTTCTGAACCCTGGGCTGG - Intronic
1189159166 X:38793051-38793073 AAAGATAGTTAACACTGAGCTGG - Intergenic
1190383631 X:49863307-49863329 AAAGTTTCTTACCAGTGGCCAGG - Intergenic
1197821272 X:130543204-130543226 AAAGATGATTAACAGTGGGAGGG + Intergenic
1198863107 X:141091846-141091868 AAAGGTGCTCAAAACAGGGCAGG + Intergenic
1198899583 X:141495541-141495563 AAAGGTGCTCAAAACAGGGCAGG - Intergenic
1200113409 X:153756650-153756672 AAAGCTGCTTGGCACTGGTCTGG + Intergenic
1201324768 Y:12744430-12744452 AAAGTTGCTTACCTATGTGCAGG + Intronic