ID: 1039609100

View in Genome Browser
Species Human (GRCh38)
Location 8:38904810-38904832
Sequence CTGCAAAGTTGCTTAACACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039609100_1039609102 8 Left 1039609100 8:38904810-38904832 CCCAGTGTTAAGCAACTTTGCAG 0: 1
1: 0
2: 0
3: 9
4: 138
Right 1039609102 8:38904841-38904863 ATGACCATGTACTCCTTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039609100 Original CRISPR CTGCAAAGTTGCTTAACACT GGG (reversed) Intronic
902600682 1:17538976-17538998 CTCCAAAGCTGCCAAACACTAGG - Intergenic
903021981 1:20401055-20401077 CTGCAAAGAGGCTTAACATAGGG + Intergenic
906333517 1:44907952-44907974 CTGCAAAGTTACTTTACAAAAGG - Intronic
910022041 1:82603215-82603237 CTGGAGAATTGCTTGACACTAGG - Intergenic
910903611 1:92149683-92149705 CTGCAATGTTCATTTACACTAGG + Intergenic
915993943 1:160545572-160545594 CTCCAAAGTGCCTTTACACTAGG + Intronic
917099124 1:171428321-171428343 CTTCCAAGTTGCTGGACACTTGG + Intergenic
919401003 1:197116471-197116493 TTGCAGACTTGCTTAACACAGGG + Intronic
919747126 1:201015839-201015861 CTGCAAAGATGATTAAGCCTGGG + Intronic
924839838 1:247697334-247697356 CTCCAGAGTTGCTTAACACCTGG + Intergenic
1064959280 10:20945619-20945641 ATTCCAAGTTTCTTAACACTGGG - Intronic
1068429212 10:56910562-56910584 ATGCAAAGGTTCTTAACTCTGGG - Intergenic
1068901838 10:62278171-62278193 CTGGAAAGTTGCCTGTCACTGGG - Intergenic
1071468570 10:85962269-85962291 CTACAAAGTTGCTTAGCATCTGG + Intronic
1073014958 10:100391287-100391309 TTGCCAAGTTTTTTAACACTTGG - Intergenic
1074597039 10:114876986-114877008 CTGCAGAATTGCTCAATACTGGG - Intronic
1075451405 10:122554208-122554230 CTGCACAGTTCCTGAACAATGGG - Intergenic
1076398442 10:130159450-130159472 CTGCAAGGCTGCTGGACACTAGG - Intronic
1078366695 11:10712415-10712437 CTACAAAGGTGCTCAACCCTTGG + Intergenic
1079179644 11:18178793-18178815 CTGCAAAGTTTCGAAACAATTGG - Intronic
1080148933 11:29024837-29024859 CTTAGAAGTTGATTAACACTAGG + Intergenic
1080525124 11:33108484-33108506 TTGCAAAGTTGGTTAAAAATTGG - Intronic
1090859103 11:130637397-130637419 CTGGAAGATTGCTTAACCCTGGG - Intergenic
1092497299 12:9009492-9009514 CTGTGAAGTTCCTTTACACTGGG + Exonic
1093365459 12:18291006-18291028 TTGCAAGGTTGCTTACCACATGG - Exonic
1096916578 12:55039810-55039832 CTGCACAGTTCCAAAACACTTGG + Intergenic
1097690400 12:62729247-62729269 CTGCAAAGGAGCTTAAGAGTTGG + Intronic
1098263211 12:68692673-68692695 CTGCAGAATTGCTTAAGCCTGGG - Intronic
1098871373 12:75820930-75820952 CTTCAGAGTTGCTCACCACTGGG + Intergenic
1099828075 12:87804614-87804636 CTGCAAAAATGATTAACAGTAGG - Intergenic
1100576933 12:95900720-95900742 GTGCAAAGTGGCTTAACAGGTGG + Intronic
1101847613 12:108375180-108375202 CTGCCAACTTGCTTCCCACTGGG + Intergenic
1104319207 12:127734773-127734795 CTGCACATTTGATTAACTCTAGG - Intergenic
1108463488 13:50691691-50691713 ATGCTAAGATGCTTAGCACTGGG - Intronic
1110757141 13:79188812-79188834 CTTCAAATTTGCCTAGCACTAGG + Intergenic
1111878616 13:93927147-93927169 CAGCAAAGTTACTTAATTCTAGG - Intronic
1120650971 14:87132255-87132277 CTGCAAAGTCATTTAACCCTTGG + Intergenic
1121946380 14:98126679-98126701 CTTCCAAATTGCTGAACACTTGG - Intergenic
1123860317 15:24459227-24459249 GTGCAAATGTGTTTAACACTTGG + Intergenic
1123863947 15:24497854-24497876 GTGCAAATGTGTTTAACACTTGG + Intergenic
1126907700 15:53385329-53385351 CTGCAGAGTTGCAAAAGACTTGG + Intergenic
1127821414 15:62659377-62659399 CAGCAAAGGTACTTAAAACTGGG + Intronic
1135224988 16:20648007-20648029 CTGCAAAGTTCCTGAGCTCTGGG - Intronic
1135380333 16:21990997-21991019 CTGCAAAGTTGATTTACTGTAGG - Intronic
1136527442 16:30841209-30841231 CTGCAAATTTGTTCAATACTGGG + Intronic
1138145826 16:54611127-54611149 CAGCAAGGTGGCTTAAGACTAGG - Intergenic
1139432452 16:66918417-66918439 CTGGAAAGTTCCTGAAGACTTGG + Intronic
1141048233 16:80736559-80736581 CAGCAATGTGGCTGAACACTGGG + Intronic
1142455955 16:90223161-90223183 CTACAACATTGCTTAACACAAGG - Intergenic
1143063825 17:4226648-4226670 CTGCAGAGTTGCTTGAACCTGGG + Intronic
1143360739 17:6368248-6368270 ATGCAAAGTTGATTAACATTTGG + Intergenic
1148273935 17:46286162-46286184 CTGAAAATTTGCTAAACCCTGGG + Intronic
1149558707 17:57593031-57593053 CTGCAAGGTGGCTTTAAACTAGG + Intronic
1149801998 17:59578109-59578131 ATGCAAAGTTCTTTAAGACTGGG + Intronic
1149844492 17:59997376-59997398 ATGCAAAGTTCTTTAAGACTGGG - Intergenic
1150178999 17:63095044-63095066 CTGCAAAGTTGCATAGCATAAGG - Intronic
1150409117 17:64928423-64928445 CTGAAAATTTGCTAAACCCTGGG - Intergenic
1150761230 17:67964119-67964141 CTGAAAATTTGCTAAACCCTGGG - Intronic
1150874691 17:68957167-68957189 CTGAAAAGTAGCTTAGGACTAGG - Intergenic
1150920790 17:69480004-69480026 CTGCAGAGTTACTTAACTCTTGG + Intronic
1153282152 18:3424789-3424811 CTTCTGAGTTGCTTAACCCTTGG + Intronic
1158708260 18:59814206-59814228 CTGCAAAATTTCAGAACACTGGG + Intergenic
1159402172 18:67952959-67952981 GCGCAAAGTTGTCTAACACTAGG - Intergenic
1160016055 18:75141592-75141614 CTGACAAGTTGCTTGACAGTGGG + Intergenic
926470663 2:13252730-13252752 CCCCAAGGTTGCTTAACTCTGGG - Intergenic
927405690 2:22763719-22763741 CTGCAAAGTGTATGAACACTAGG - Intergenic
928620587 2:33084013-33084035 ATGCAAATTTAATTAACACTCGG - Intronic
929897065 2:45969807-45969829 CTGCAAATTTGCTTGACATTGGG + Intronic
931157822 2:59655326-59655348 ATGCAAAGTTTCTTAGGACTTGG - Intergenic
935751615 2:106239917-106239939 CTGGAGAGTTGCTTAAACCTGGG + Intergenic
937618845 2:123961584-123961606 CTTCAAAGTTTCTTTACCCTTGG - Intergenic
938271205 2:129973489-129973511 CTGCAAAATTGCTTTTCAGTCGG - Intergenic
941185924 2:162321343-162321365 ATGAAAAGTTGCATAACAATGGG - Intronic
944192819 2:197021695-197021717 CTGTAAACTTACTTAACATTTGG - Intronic
945759059 2:213889104-213889126 CAGCAAAGTTGTTTAAGATTTGG - Intronic
947014355 2:225601634-225601656 GTGAAAAGATGCTCAACACTGGG - Intronic
947264542 2:228262450-228262472 CTGGAAAGTTACATAACATTCGG - Intergenic
949087453 2:242167962-242167984 CTACAACATTGCTTAACACAAGG - Intergenic
1168894908 20:1317712-1317734 CTGCAAAGTTGTCTAAGGCTGGG - Intronic
1169996936 20:11568844-11568866 ATGAAAAGTTGCCTAACATTAGG - Intergenic
1171428805 20:25065713-25065735 CTGCAAAGGTGCTGATCGCTAGG + Intergenic
1175676593 20:60951418-60951440 CTGCTGAGTTGCTTTACTCTGGG - Intergenic
1178281117 21:31283862-31283884 CCGCAAAGCTACTGAACACTTGG + Intronic
1178285308 21:31320897-31320919 CTGCAAAATTGCTTGAACCTGGG + Intronic
1182039912 22:27229837-27229859 CTGGAAATCTGCTGAACACTGGG + Intergenic
1182938494 22:34250281-34250303 ATGTAAAGTTGCTCAACATTGGG - Intergenic
950129588 3:10532902-10532924 CTGCAAAGTTTCTTCTCTCTGGG + Intronic
950972095 3:17199558-17199580 CTGCCAAATTGCTTAACTTTGGG - Intronic
953648837 3:44781087-44781109 CTGCAAACATGATTAACACATGG - Intronic
955632418 3:60988777-60988799 CTAGAAAGTTGTTTAAAACTAGG - Intronic
958649483 3:96919814-96919836 CTGTAAAGTTAAATAACACTTGG - Intronic
962781825 3:138726367-138726389 CTGCAACTATGCTAAACACTAGG + Intronic
963593355 3:147292077-147292099 ATGCAAAGAAGCTCAACACTGGG + Intergenic
968243213 3:197112378-197112400 ATGAAAAGGTGCTTAACATTAGG - Intronic
973875972 4:55218801-55218823 CTGCAAAGGTGCTATGCACTTGG - Intergenic
974115541 4:57575042-57575064 CTGGAAATTTGGTAAACACTAGG - Intergenic
975110078 4:70613592-70613614 CTGGAAAGCTGCTGAACCCTGGG - Intergenic
978976162 4:114876576-114876598 CTGAAGAGTTGCCTAAGACTGGG - Intronic
979050743 4:115928589-115928611 CTGCACAGTTGCTTCACACAAGG + Intergenic
979949955 4:126879869-126879891 CTGCCAAGTTGCCCAACACCAGG - Intergenic
983110467 4:163743189-163743211 CTGGAATGTTGACTAACACTGGG + Intronic
984332603 4:178344712-178344734 CAGGAAAGTTGCTTAAACCTGGG - Intergenic
984531887 4:180926030-180926052 ATGCAAAGTTGTTTAACTTTTGG + Intergenic
986525098 5:8665065-8665087 CTGTAAACTTGCTTAAGTCTAGG - Intergenic
986888807 5:12274836-12274858 TTGCAAAGTTGCATAGCACCTGG - Intergenic
989007573 5:36831826-36831848 CTGCAGAGTGGCTTAATAATAGG - Intergenic
989298487 5:39860047-39860069 CTGTAAAGTTGCTTAAAAACGGG - Intergenic
990147041 5:52773917-52773939 CTTTAAATTTGCTTATCACTAGG - Intergenic
993210983 5:84951105-84951127 CTTCCAAGTTGCTGAACACATGG + Intergenic
993597240 5:89872920-89872942 CTGCAGAGTTATATAACACTGGG - Intergenic
994860699 5:105188946-105188968 CTGCCAGGATGCTTAATACTGGG - Intergenic
994936910 5:106266052-106266074 CTAAAAAGTTTCTTAACAGTTGG + Intergenic
995017681 5:107330062-107330084 ATGCAAAGTTGTATAAGACTAGG + Intergenic
995519081 5:112983640-112983662 CTGCAAAATTTCACAACACTGGG + Intronic
996488817 5:124068094-124068116 CTGCAAACTTGCTGAAGTCTGGG + Intergenic
999083919 5:148870354-148870376 CTTCAAAGTTTCTTTACACTTGG - Intergenic
1000974823 5:167753226-167753248 CGGAAAAGTTGCTAAAAACTTGG + Intronic
1001409055 5:171497344-171497366 CTGGAGAGTTGCTTAAGCCTGGG - Intergenic
1003174667 6:3745864-3745886 CAGCAAGGTTTCTTAACAATGGG + Intronic
1006900888 6:37500143-37500165 ATGCAAAGCGGCTTAAAACTGGG - Intergenic
1009481567 6:64164941-64164963 ATGCAAAAATGCTTAACACAGGG - Intronic
1010552578 6:77241171-77241193 CTGCAAAATTGCTTTTCAGTAGG - Intergenic
1012033499 6:94102243-94102265 CAGGAAAGTTGCTTAAATCTGGG + Intergenic
1015721883 6:136250753-136250775 CTGCAAAGCTGCAAAACCCTCGG - Intergenic
1022315978 7:29246133-29246155 GGGGAAAGTTGCTTTACACTAGG - Intronic
1024762994 7:52623031-52623053 ATTCAAAGTTGATAAACACTTGG + Intergenic
1024772866 7:52745036-52745058 CTGTAGAGTGGCTGAACACTGGG + Intergenic
1025112721 7:56233058-56233080 ATGCAAAGTTGTTTACCACTGGG + Intergenic
1025242500 7:57289592-57289614 ATGGAAAGTTTCCTAACACTTGG - Intergenic
1026345950 7:69474412-69474434 CTGGAAAGTTGCTTGAATCTGGG - Intergenic
1028034162 7:85958808-85958830 GTCCATAGTTGCTTGACACTTGG + Intergenic
1032331919 7:130988484-130988506 CTGCATTGTTGATTAACACGGGG + Intergenic
1033990724 7:147282821-147282843 CAGGAAAGTTGCTTGAGACTAGG - Intronic
1035497274 8:63378-63400 CTACAACATTGCTTAACACAAGG + Intergenic
1037112238 8:15177414-15177436 CTGGAAAATTGCTGAATACTTGG - Intronic
1039609100 8:38904810-38904832 CTGCAAAGTTGCTTAACACTGGG - Intronic
1042167417 8:65959116-65959138 CTGCAAAGCTGCTTAAAAATGGG - Intergenic
1050816440 9:9818821-9818843 CTGGAAAATTGCTTGAAACTGGG + Intronic
1054815567 9:69471383-69471405 CTGCTAAGCTGCATGACACTGGG + Intronic
1055429542 9:76229808-76229830 CTGCCCAGCTGCTTAGCACTTGG + Intronic
1060010013 9:120035609-120035631 CTGCAAAGTTGCAGAGCACAGGG + Intergenic
1060755899 9:126213163-126213185 CTGCAAAGTTGCATTGCAATGGG - Intergenic
1188461042 X:30427708-30427730 CTCCACAGTTGCTAAACTCTGGG - Intergenic
1195600089 X:106736841-106736863 CAGTAATGTTGCTAAACACTGGG - Intronic
1196670999 X:118367888-118367910 CTGTAAATTTCTTTAACACTAGG + Intronic
1196680402 X:118464048-118464070 CTACAAAGTTGCATAACAGAGGG + Intergenic
1197156435 X:123274878-123274900 CTACAAACTTGCTTGACACTGGG - Intronic
1197702053 X:129606911-129606933 TTGCAAAGATGAATAACACTGGG - Intergenic