ID: 1039609101

View in Genome Browser
Species Human (GRCh38)
Location 8:38904811-38904833
Sequence ACTGCAAAGTTGCTTAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039609101_1039609102 7 Left 1039609101 8:38904811-38904833 CCAGTGTTAAGCAACTTTGCAGT 0: 1
1: 1
2: 0
3: 10
4: 127
Right 1039609102 8:38904841-38904863 ATGACCATGTACTCCTTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039609101 Original CRISPR ACTGCAAAGTTGCTTAACAC TGG (reversed) Intronic
903021980 1:20401054-20401076 CCTGCAAAGAGGCTTAACATAGG + Intergenic
905046094 1:35003470-35003492 AATTCAAAGTTGCATAAAACAGG + Intronic
907185591 1:52606882-52606904 ACTGCAATCTTGCTAAACATGGG - Exonic
909487148 1:76186885-76186907 ACTGCTCATCTGCTTAACACTGG - Intronic
913104058 1:115595552-115595574 GCTGCAATGGTGCCTAACACTGG - Intergenic
918182185 1:182093943-182093965 ACTGCACAGTTTATTAAAACAGG - Intergenic
919221273 1:194631920-194631942 GATGCAAAGTTGCTGAACACTGG + Intergenic
919401002 1:197116470-197116492 GTTGCAGACTTGCTTAACACAGG + Intronic
922632155 1:227126335-227126357 ACTGCAAGGTTGCTTCAGAAAGG + Intronic
924846667 1:247781112-247781134 AGTGCAAAGTGGCTTTTCACAGG - Intergenic
1064724318 10:18262102-18262124 AGTGCTGAATTGCTTAACACTGG + Intronic
1064959281 10:20945620-20945642 AATTCCAAGTTTCTTAACACTGG - Intronic
1065048114 10:21762355-21762377 ATTGAAAAATTGCTTAATACTGG + Intronic
1068129242 10:52876860-52876882 AATGCAAAGTGAGTTAACACAGG - Intergenic
1068429213 10:56910563-56910585 AATGCAAAGGTTCTTAACTCTGG - Intergenic
1070624838 10:78043462-78043484 AGTGCAAAGTAGCTTAATACTGG - Intronic
1072892360 10:99335224-99335246 ACTGCAGAGTTGTTTAAGATTGG - Intronic
1073517968 10:104095458-104095480 ACTGTAATGTTGCTAAACAATGG + Intergenic
1075451406 10:122554209-122554231 ACTGCACAGTTCCTGAACAATGG - Intergenic
1075590877 10:123690701-123690723 ACAGCAGAGTTGGCTAACACTGG - Exonic
1076046684 10:127299931-127299953 CCTGCAAAGTTCCTTATCTCAGG + Intronic
1078244992 11:9565886-9565908 GCTGCACATTTGCTTAATACAGG - Intergenic
1087056612 11:93942824-93942846 ACTTTAAAGTTGCTTCTCACAGG - Intergenic
1091847385 12:3667990-3668012 GCTGCAAAGTTGGTTTATACAGG - Intronic
1092307151 12:7313167-7313189 ATTGCAAAGTTGTTTAGGACAGG - Intronic
1092835203 12:12481021-12481043 ACAGAAAAGTTGCTTAAAATAGG - Intronic
1095386178 12:41653315-41653337 ACTGAGAAGTTGCTGAACATTGG + Intergenic
1096732355 12:53624966-53624988 ACTGCAAAATTTTTAAACACAGG + Intronic
1098871372 12:75820929-75820951 ACTTCAGAGTTGCTCACCACTGG + Intergenic
1102637530 12:114337099-114337121 ACTGCAAAATTCCATCACACTGG + Intergenic
1102777541 12:115533612-115533634 ACTCCAGAGTTGCCTAAGACAGG - Intergenic
1105397176 13:20048116-20048138 ATTGCACAGTTTTTTAACACAGG + Intronic
1107095578 13:36531443-36531465 ACTGCAAAGCTACATAGCACAGG + Intergenic
1108278541 13:48837345-48837367 AATGCAAGGTTGCTTAATATTGG - Intergenic
1108463489 13:50691692-50691714 AATGCTAAGATGCTTAGCACTGG - Intronic
1110423764 13:75341922-75341944 ACTGCACAGTGGTTTAAAACAGG + Intronic
1115871855 14:37813531-37813553 ATTGCACAGTTGCTACACACCGG + Intronic
1117305512 14:54469701-54469723 ACTGCAAAGTAGTTGAACAAGGG + Intergenic
1120717330 14:87853992-87854014 ACTGCAAAAATGCAAAACACAGG + Intronic
1121595720 14:95160554-95160576 ACTATACCGTTGCTTAACACGGG - Intergenic
1126360434 15:47840286-47840308 ACTGCAAAGTTACATCACAAAGG - Intergenic
1135231604 16:20713647-20713669 ATTGCAAAGTTGTTTAGGACAGG - Intronic
1137299962 16:47139457-47139479 ACCACTGAGTTGCTTAACACAGG - Intronic
1138988080 16:62355892-62355914 ACTTCCAGGTTGCTGAACACTGG + Intergenic
1141048232 16:80736558-80736580 ACAGCAATGTGGCTGAACACTGG + Intronic
1141459189 16:84167314-84167336 GCTTCCAAGTTGCTGAACACTGG - Intronic
1142277692 16:89131519-89131541 AATACAAAGTTACTCAACACGGG - Intronic
1143787677 17:9268313-9268335 ACTTCAAAGTTGCTCTACACTGG + Intronic
1147552334 17:41452513-41452535 ACTGCCAAGCTGCGTGACACAGG - Intergenic
1149801997 17:59578108-59578130 AATGCAAAGTTCTTTAAGACTGG + Intronic
1149844493 17:59997377-59997399 AATGCAAAGTTCTTTAAGACTGG - Intergenic
1150238020 17:63608816-63608838 ACTGCCAAGTCCCTTATCACTGG - Intergenic
1152080529 17:78184652-78184674 ACGGCAGAGTTTCTGAACACTGG + Intronic
1158185257 18:54764165-54764187 AATGCAAAGATGGTAAACACAGG - Intronic
1158708259 18:59814205-59814227 ACTGCAAAATTTCAGAACACTGG + Intergenic
1166018972 19:40007549-40007571 AAGGTGAAGTTGCTTAACACAGG - Intronic
928997999 2:37316314-37316336 ACTGCAAATTGGCCTCACACGGG - Exonic
929344988 2:40871028-40871050 ACAGCAAAATTCCTTCACACAGG - Intergenic
929897064 2:45969806-45969828 CCTGCAAATTTGCTTGACATTGG + Intronic
935610382 2:105017586-105017608 ATGCCAAAGTTTCTTAACACTGG - Intergenic
936651728 2:114435333-114435355 ACAGCCAAGTTTCTTAACAGTGG + Intergenic
938479327 2:131646645-131646667 ACTGCAAAATTGCTTTAAAAAGG + Intergenic
939211550 2:139181608-139181630 ACTGTAAGGTTCCTTAACACAGG + Intergenic
939543573 2:143523956-143523978 TCTGCAAAGTTGCTTATACCTGG - Intronic
939862349 2:147435418-147435440 ACTGCAGAATTACTTTACACTGG + Intergenic
939978672 2:148751899-148751921 ACTGAAAAATTAGTTAACACTGG + Intronic
940805953 2:158186673-158186695 ACTGCAAAATTTCTTAACTGAGG + Intronic
941185925 2:162321344-162321366 AATGAAAAGTTGCATAACAATGG - Intronic
943194850 2:184732872-184732894 ACAGCAAGGTTGCAAAACACAGG - Intronic
945893165 2:215452207-215452229 ATTGCAAAGATGCTTGACAGTGG + Intergenic
1168894909 20:1317713-1317735 ACTGCAAAGTTGTCTAAGGCTGG - Intronic
1169545591 20:6647481-6647503 ACTACAAAATTCCTTACCACAGG - Intergenic
1170808319 20:19653662-19653684 AATGCAAAGTTGCCTATCAGAGG - Intronic
1181821330 22:25477914-25477936 ACTGCAAAGTCGCTTGGCAAGGG + Intergenic
952096870 3:29964320-29964342 ACTCCAACGTTTATTAACACTGG + Intronic
952148463 3:30559783-30559805 ACTGCAAAAATGCTTAAGACTGG - Intergenic
953239878 3:41139283-41139305 ACATCAAAGCTGCTTAACATGGG + Intergenic
960659404 3:120041616-120041638 ACTGATAATTTGCTTAACCCAGG + Intronic
962146694 3:132847091-132847113 ACTGCAAAGTTCAATAACAATGG - Intergenic
964052645 3:152415106-152415128 ACTGAAAACATGCTTACCACGGG - Exonic
964323264 3:155519721-155519743 AATGCAAAGTTCCTCAACTCTGG - Intronic
967364883 3:188674885-188674907 ACTTCAAAGTTTATTATCACAGG + Intronic
972668548 4:41191683-41191705 AGGGAAAAGTTCCTTAACACTGG + Intronic
977255894 4:94739678-94739700 ACAGCAAAGTGGCTGGACACAGG - Intergenic
980314516 4:131180019-131180041 AATGCAAAATTACATAACACTGG + Intergenic
981633441 4:146848082-146848104 GCTACAAAGTTTCTCAACACTGG + Intronic
982186352 4:152805424-152805446 ACGGCATCATTGCTTAACACTGG + Intronic
986166130 5:5272946-5272968 ACTCCAAAGTTGAGTAAAACTGG - Intronic
988237952 5:28571322-28571344 ACTACAAGGATGCTTGACACTGG - Intergenic
988289220 5:29263993-29264015 ACTGCAAAGTTGCATGCCAATGG - Intergenic
989141656 5:38207583-38207605 ACTGCAAAGTTACCTAACAAAGG + Intergenic
989298488 5:39860048-39860070 ACTGTAAAGTTGCTTAAAAACGG - Intergenic
990737711 5:58881866-58881888 ACTGCAAAGTTGTGGAACAAGGG - Intergenic
991598333 5:68327386-68327408 ACTGGAAACTTACTTAACAACGG + Intergenic
995519080 5:112983639-112983661 ACTGCAAAATTTCACAACACTGG + Intronic
996961009 5:129249699-129249721 ACTGCAAATCTGGTAAACACTGG - Intergenic
1002969881 6:2004551-2004573 AGCTCATAGTTGCTTAACACAGG + Intronic
1007224420 6:40302885-40302907 GCTGCAAAGTGGCCTAGCACAGG + Intergenic
1009481568 6:64164942-64164964 GATGCAAAAATGCTTAACACAGG - Intronic
1012152593 6:95773335-95773357 ACTGCTCAGTGGCTTAACAGTGG + Intergenic
1012599647 6:101079386-101079408 ACTGAAAATTTGCTCAACATGGG + Intergenic
1013734623 6:113211395-113211417 AATGCAAAGTTGCTTTCCAATGG - Intergenic
1015307119 6:131722186-131722208 AGTTCAAAGTAGCTTTACACTGG - Intronic
1016169530 6:140993918-140993940 AATGCATAGTAGCTTCACACTGG + Intergenic
1020370521 7:7427328-7427350 ACTGCAAAATTGCTTCAGCCTGG - Intronic
1021434334 7:20597329-20597351 ACTGTAAAGTTGCTACACCCTGG + Intergenic
1025112720 7:56233057-56233079 AATGCAAAGTTGTTTACCACTGG + Intergenic
1026303666 7:69121411-69121433 AATGCGAAGTTGTTTACCACTGG - Intergenic
1028968779 7:96832872-96832894 ACTTCTAAGTTCCTGAACACAGG - Intergenic
1032331918 7:130988483-130988505 TCTGCATTGTTGATTAACACGGG + Intergenic
1033977725 7:147123270-147123292 ACTTCAAAGTTTATTAACAGAGG - Intronic
1035755774 8:2031203-2031225 ACTACACAGCTGCTTGACACAGG + Intergenic
1037840626 8:22242854-22242876 ACTGCCAAGCTGCTTTCCACAGG - Intergenic
1039609101 8:38904811-38904833 ACTGCAAAGTTGCTTAACACTGG - Intronic
1039668304 8:39562469-39562491 AAGGCAAATTTGCTTAATACTGG + Intergenic
1042167418 8:65959117-65959139 TCTGCAAAGCTGCTTAAAAATGG - Intergenic
1042744766 8:72095948-72095970 ACTGCACTGCTGCTTATCACTGG - Intronic
1044043255 8:87397199-87397221 GCTGCAAAGTTTATTTACACTGG + Intronic
1044897063 8:96903778-96903800 TCTGCAAAGTTCCTTATCAAAGG + Intronic
1047885868 8:129249407-129249429 AATGCAAAGTGGACTAACACAGG + Intergenic
1051342849 9:16127773-16127795 ACTGCATAGCAGCTAAACACAGG - Intergenic
1054815566 9:69471382-69471404 ACTGCTAAGCTGCATGACACTGG + Intronic
1057058051 9:91978894-91978916 ACTGCAAAGCCTCTTAACCCTGG + Intergenic
1057956906 9:99417245-99417267 ACTGCAAAGTCACAGAACACTGG - Intergenic
1059039820 9:110800471-110800493 AATGCAAAGCTGCTCAGCACAGG - Exonic
1060010012 9:120035608-120035630 CCTGCAAAGTTGCAGAGCACAGG + Intergenic
1060412762 9:123410959-123410981 ACTCCACTGATGCTTAACACGGG + Intronic
1061607895 9:131725287-131725309 ACTACCACGTTGCTTAACAAGGG - Intronic
1061761071 9:132851696-132851718 ACTGCAAAGTTGCTGAACACAGG + Intronic
1188322465 X:28756840-28756862 ACTGAAGAGTTGCTTAACAGGGG - Intronic
1190112456 X:47602217-47602239 ACTTATTAGTTGCTTAACACAGG - Intronic
1193175932 X:78392787-78392809 AGTACAATGTTGCATAACACTGG - Intergenic
1194972599 X:100360651-100360673 ATTCCATGGTTGCTTAACACTGG + Intronic
1195474444 X:105268673-105268695 ACAGGAGAGTTGCTTGACACAGG + Intronic
1195600090 X:106736842-106736864 ACAGTAATGTTGCTAAACACTGG - Intronic
1196680401 X:118464047-118464069 ACTACAAAGTTGCATAACAGAGG + Intergenic
1197156436 X:123274879-123274901 TCTACAAACTTGCTTGACACTGG - Intronic
1199988360 X:152968833-152968855 ACTGGAAAGATGCTCAACCCAGG + Intronic
1200125015 X:153809248-153809270 ACTGCAAAGTAGCCTAAAAGAGG + Intronic