ID: 1039609102

View in Genome Browser
Species Human (GRCh38)
Location 8:38904841-38904863
Sequence ATGACCATGTACTCCTTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039609101_1039609102 7 Left 1039609101 8:38904811-38904833 CCAGTGTTAAGCAACTTTGCAGT 0: 1
1: 1
2: 0
3: 10
4: 127
Right 1039609102 8:38904841-38904863 ATGACCATGTACTCCTTGTTAGG No data
1039609100_1039609102 8 Left 1039609100 8:38904810-38904832 CCCAGTGTTAAGCAACTTTGCAG 0: 1
1: 0
2: 0
3: 9
4: 138
Right 1039609102 8:38904841-38904863 ATGACCATGTACTCCTTGTTAGG No data
1039609099_1039609102 12 Left 1039609099 8:38904806-38904828 CCTGCCCAGTGTTAAGCAACTTT 0: 1
1: 0
2: 0
3: 5
4: 156
Right 1039609102 8:38904841-38904863 ATGACCATGTACTCCTTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039609102 Original CRISPR ATGACCATGTACTCCTTGTT AGG Intronic
No off target data available for this crispr